Tupaia_belangeri Locus NOL5A
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri NOL5A
Tupaia_belangeri
NOL5A
GeneScaffold_5512
SNORD110, SNORA51, SNORD86, SNORD56, SNORD57
2694..2763, 3708..3839, 4539..4624, 5083..5153, 5402..5472
7572
ATGTGTGCCCAAGATCCCAAGAGGAGAATAGAGAAGGGATTGCAATGTGGACATTCCCC
TTGGGGGGTGATTTCTTGCTTTCTGCCTCTCTTTCTGGCCAACACACGTGCCCTATAGCA
AAAACCTTTCAAAAAAACCAAAAACACAAAAAAAGTGAAAGTATCTGATTTCAGTGGAGT
ATATTCAGATATGATTACAAGTATCAGTACTGTTTAACAAAATGTGAACACATCTCTAAG
AAATATTGAGATAAAGAGATTTAAAGATTTACCAATTTACCAACTATAGTTTTAGGTTTA
ATGTATGAATAAACTAAGGGGGGAAAAAAAAGAGAACCAAGAACTTATATTCAAGTAATT
GAATCGACTAAGAAGTAAAATACTGTTATACTAAATGTATAGATATGATTTATAGTTATA
AAAAATCTATAACTTACATTCTTACGAAAAATTTTGTAAATCCTTAGAATATTTCTAATT
TACCAGGCATATACTAATTAAGGTTTTATTAGATTTACAACGCTCCTATTAATTAATAAG
GCAAAACTAACTTCAAAATAATCTCCTGAATGCCCCCAAACCCTAGATACCGATTCATTC
ACTCCGAGCTCACAGGGAGTAAAGAATTCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCGGAGCCGGGTTCCGCGCGCCAGA
GCCCGCTAGCTGCATTGCGAGCCGGGCGAGCAGCGGGCGCCATGGTGAGGAGTGGTAGCG
GGTCGCGGTCAAGGCGAAGGCAGTTCTCTGGGCCTGGGTTCGGGCCTGCGCCCATTCCTG
TGCCGGGGCCTGCCTTGGGATCGGGGCCGGGCGAAGGCGGGGGCCCCGCTGACGCTCGCG
CCCCGGCTCCCGTTCCAGGTGCTGCTGCACGTGCTGTTCGAGCACGCGGTCGGCTACGCG
CTGCTGGCGCTGAAGGAGGTGGAGGAGATCAGTCTGCTGTTGCCGCAGGTGGGTGGATCT
GTGGGCTCGCTTTGCCGCGCCGCAGCCCCCAGCCGGCGCGGGCCCCGGCATGCACCGCGC
GCTCCCACGTGGCCGACCGCGCGGGTTGGGGTGGGGGCCGGCCCTGGAAAGCTCTGGAGC
AGGGGTCCTTACCTTGTTTTAGGACTAGAATCACTTTAGGCGCAATATGCAGTAAGCTTC
CCAGACTCCACCTCGTACTGATTAAAGCAGAATCTGGAATGTGGGGCCGGGATCGGTGTA
TTTTAAAAGCATCCAGGTTGAAAACTGCCTTATTGCGCTGCAGGCAAGAGTGAGAGAAGG
AGACTAGGCATCCTTTTTATCCCTCCAGGTGGAGGAGTGTGTGCTCAGCCTGGGCAAGTT
TCACAACATCGTTCGTCTCGTGGCCTTTAGTCCTTTTGCCTCTTCCCAAGTTGCCTTAGA
AAATGCCAACGCGGTTTCTGAAGGTGAGTCGGCCCCAGCCGATTATTTCAGGAAGATAAC
GCGAGATGTGGTTCCTGCCATTAGCTGTCTGAAGGGCCAGTAATAACGGTTGCTTTAAGC
CAGTTCCAAATCTGATAGACGCTGGGCAGCATTAGAGATGTACAGAACGGAATTTTTAAG
TAATTGTCTTCACAGATTCTAACGTCTGTGAAATAATAGACTAAGTGGTCGGCATCTAAC
ACACACAATCCAGACATAGTTATTTCCTTGTAGGCACTGTAGTGGTTCTTAACTAGAATC
TGGAGAGAAGTGTTGCTTTAATGCTCACCTGTGCCCATGTTTGCCTAAGCACAGTAGAAT
GTCTAGTCTCTGCTATATCAACTGATTGGAAAACAGAATTCTGATAAATAAAAACCAGAA
AAAGATTTGGATCTAGAATGCAAACTGGGTACTAAATACTTAAGGATGTGGAAGCCAGTG
GGTGATGGAGTGGTTAAGGCACATGGCCCACCTCCGTTTGAGTCTAGAACCTGCCAGCTT
GAAACTCACGCTGGGCGCATGTGTACATATGCCCCAAATCCCAGAAGGTAGAGGGGATTG
TGGGTGACCATCCCTCCTAGGGGGTGATTTCTCACTTTTCCTTCTCACTGTCTCCTGCAA
ATGCATGTGCCTTTTGGTAATTTTTTTTTTTTTGAGAGGTTTTTGCTATAGGGTTTCAGA
AAGCGAGAAATCACCTGCAAGGGGATGGTCACGCCACAATCCCTTCTGCATTCTCCTCTC
GGGACTTTGGGCACGCACATGCACACTCCCGGCGTGAGTTTTGAGCCACCAGGTCCGGGT
CTCAAACCATGGTCAACTGCATTGGAGTCCAGCAACATAGCCATTACGCCAACTGCTGGT
CCCAGCAAAAATCTTTTTAAAAAAAATACTTAAGTGTGTGTCATAAGTTCTCAGTGTTGT
GGTCCATATTTGTGCTATTCGATCTGAGTCCGGTTCCCTCTGGTTGAGCAGGCTTTGCAG
TGATGACTTGTTAATCTGTCAATCCCCTGAGTGCAGTCACTGATGTCTCCATGTCTCTGA
GCAATGCCTGGAAAGGAGGGATCCTGGGCATGCTATCCCAGCATGCTCCCCTGGGCCAGT
ATTTCTTAACTGAGGGGCTAGGGTAGGACCCTTTTGCAGTCGGTGTAAGCATCCTCCAGT
GTGTTAGTGGAAGCTGTGTTTTTTGCCCTGAGGTGTTGTTCATGAGGACCTCCGCCTGCT
CCTGGAGACCCACTTGCCGTCCAAAAAGAAGAAAGTGCTCTTGGGGGTTGGTGACCCCAA
GATTGGTGCTGCTATACAAGAAGAGTTAGGGTACAATTGCCAGACTGGAGGCGTGATAGC
TGAGATCCTGCGAGGTAAGGCCATCGTGTTGTATTATTGATGTATTTCAGGGGTGCTCTG
GCAGCTTGCCTGGGTTGTTAAAGGTTGCTTTTGGGGAGGCCTCCTGCTTGGCTGGTGTCT
GTGGGTGCAGGAGCTAGCTCAGCCCTTCCTTGCTCACAGTCACGCCCCCTCCCCTTGCCC
TAGGAGTCCGTCTGCACTTCCATAATCTGGTGAAGGGTCTGACTGATCTGTCAGCTTGTA
AAGCCCAGCTGGGACTGGGACACAGCTATTCTCGTGCCAAAGTGAAGTTTAATGTGAACC
GAGTGGACAATATGATCATCCAGTCCATTAGCCTCCTGGACCAGCTGGATAAAGACATCA
ACACCTTCTCCATGCGTGTCAGGTAACTTGCCAGGGCCACCCATGATGATGGAATCTTGG
TCCATAGGATAGCTCATCTTTATCCATTTTTTATTTAATTTCATCAGAGAGTAAAGGAAA
GTAAGAAAGCAAGCCACCAGGTCCAGGACTCAAACCATGGTCAGTCATGTGGAAGTCCAG
CGCTCTTAACCACCATACCACCTGCTGGCCTTGGGATAGCTAATCTTGAATCCTGAGATC
AGGACTGACCGTTTCTGTGGGTAGGACCACAGGGCCTGGGGCAGTCTAGGCCTCCTGGTG
CTTACCACAGGCTGTGTTCCTACACTGACTGTATAGAAGGAGGAGGCAGAGTAAACCTAC
CCCATATACACCTCAGCCCAGGCCCTGTGCCTAGTCTGTATTGTGAATGGGGAGACACAG
AACCGAGAGGGACTTGTTTCCATTTCCTGTGGGCAGAGTAGGTGTGGAGGTGGTTAAGAT
TGGAGCTTTGAGCTGGGTCGGCTGGACCAGGGAGTACTGTGGCTCTTTGCAGGGAATGGT
ATGGGTATCACTTTCCGGAGCTGGTAAAGATCATCAATGACAATGCCACATACTGCCGCG
TTGCCCAGTTCATTGGAAACCGAAAGGAGCTGAATGAAGAGAAGTTGGAGAAGCTGGAAG
AGCTGACAATGGATGGGGCCAAAGCCAAGGCTATTCTGGATGCCTCACGGTCCTCCATGG
GTCAGTGCAGAGCCTGGCAGCAGCATAAGATGTGGGGCCCTTGGGAGCTGGCTTCTGTAT
TCACACTTGGTGTTTCCTAGGCATGGACATTTCTGCCATCGACCTGATAAACATCGAGAG
CTCTCCAGTCGTGTTGTGTCTTTTGTCAGAGTATCCGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCATGCTGGCAGCCTCACCAACTTGGCCAAGTATCCAGCATCCA
CAGTACAGATCCTTGGGGCTGAGAAGGCCCTGTTCAGGTACCAGTGAGGGCACCTGCCCG
TGCTCAGGTGCCACTTCTGGTGCCCACTGCTTGTTGAGGGATCACAGTGATGGCTGACCA
GGGCTTCCTGACCTATGCAGGCCTCTGCTATGGGAGTGATGGCCAGTCCTGGTGTCTGAG
TGATTCCCAGGGCCCAGCAAAGGGACCAAGTTTCCAGATCAGCGACATCAGGTGCCTTCC
CTCTGCCTCTGGGAGCTGTGGGTTGGCATGTGTTGGGTAGAGATCCAGCCTCTTAGGCTC
GCTCTGGAGACTTAAAAAAAGGCAGGGAAGGGAGGCACTGCCTTGGCTGGCTAAACAGGG
CTTTAGGTTTCTGATCTTAAATTCTCTACTGACTCTTCCCTCAGGGCCCTGAAGACAAGG
GGTAACACTCCAAAGTACGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCCGCTGCC
AAGAACAAGGGCCGCATCTCCCGATACTTGGCAAACAAATGCAGCATTGCCTCCCGGATC
GACTGCTTCTCTGGTACGGGGGCAGGGGTGGCAGTCCTGAGATAGGACTGGCAGTCCTGA
GATAGGACTGGGGGTGTGTAGAGGCCAACTGCCTGAGCAGCTTCTACAATGATGCCAATA
TTTTTCGTCAACAGCAGTTCACCTAGTGAGTGTTGATAATTTGGGTCTGAGTGAAGCTGA
GTGTGTACCCGGAATACTGAGGGTGGGGGGTGACTGTCACTAGAGCTTACAGACTTTGCT
TGTCCACACACCCCCAGAGGTGCCCACAAGTGTCTTTGGAGAGAAGCTTCGAGAACAAGT
CGAGGAGCGGCTCTCCTTCTATGAGACTGGAGAGATTCCACGAAAGAATCTGGATGTCAT
GAAGGAAGCAATGGTCCAGGTCCGTTGGGGCTTCGCTGGGTGGGAAAACCAGAGCTTGCT
GTTGGACATGATGAATTGTTCTAACCTGACCTCGTAGATGGAGGCAAAAAAACTGATTTA
ATGAGCCTGATCCAGTATACAGCCAGAAAAGGCACCTTGGGAAGCTACGTGCTCTTCTGG
CCTTTTCAGAGCTTTTCTTTGACCAGGCAGAGGAAGCTGCCGCGGAGATTACGAGGAAGC
TGGAGAAACAGGAGAAGAAACGCTTAAAGAAGGAGAAGAAACGGCTGGCTGCACTTGCCA
TGGCGTCTTCGGAAAACAGCAGTACTCCAGAGGAGTGTGAGGTCAGTAGTCCGGTCTGCC
TGGGTACAGATCCCAGGTTGGAGGATTTTCAGCAGAACAAAGGATGTGCTGCATTAAGCC
ATGGTCAAGTCCAGACTTCGAACTAAAACAAGGACCTGAAACATCTAAAACTGCCTCTAG
GTTCTATAGGAAGACAGGAGCTGGTTGCAGCACACACTCATTCCCTGGGCAAGTGTGTTC
TGTCCTCAGCTGCCTCCCAGGAGTCCTCAATGTGGGGGAGGGGGGGCATGGTATAAACTC
CCGCTCTGCTTGTTCTCAGATGGACATTCATCCCCTGGGGGAGGGACATGCCCAAAGTAG
TATTTCCAGCCTATTTCATTATATTTTTTTCCCCTGACTTCTAATTGGGTATAGCCTTTC
TGGTGGATTTCTACATCATAAAGCATTCCAGAAACACTGGACAGTTTTAACAGCTTTACC
AGTCTTTCTGAGATTTTAATGGGGGGTGGTACATCCTTACAATAGGCAACTCTCATGCCA
GCCTCCCGTTTACCTCTTTAGGAGACAGGTGAAAAACCCAAAAAGAAGAAAAAGCAGAAG
CCCCAGGAGGTTCCTCAGGAGAATGGAATGGAAGACCCAGTTCTCTCTCCCCCCAAACCC
AAGAAAAAGAAATCTTTTCCTAAGGAGGAAGTGGTTAGTAGTGACCTTGAAGAAACGGCT
GGCAGTGTAAGTCTCCCCAAGAAGAAGAAATCTTCACCCAAAGAGGAAATGATCAGTGAT
CCTGAAGAGGCAGCCAACAGGAGTGTCCCCAAGAAAAAAAGGAAATTCTCTTCTAAGGAG
GAGCCAGTCAGCAGCGGACCTGAAGAGGCTGCTGGCAGCAAGAGCAGCACTAAGAAAAAG
AAAAAACTCTCAAAACGTGCCCAAGAAGATTAGAATGGACATTCATTCTTTGGGGGGAGG
GGCATGCCCAAAGTGGTATTTCCAGCTTATGTCCTTAAACCCCAATAAAAACAAATCCAC
AGAAGTTTATTACACACATGATTTTTATTGAACACCTTACATAGATGTGGGCATGACCTA
TGGGTGGGGCAAGGCAGCAATAACAGCCTCAGTGAAGTCGTGGCATGTGGCATAGCCACC
CATGTCATGAGTTCGGACCTGTGGGGGAGAATTGTCATCATCCCTGTGGCCTGGGCCCCT
TCCCTAACAATTCCTCACCACCACCCAACACACAGTTCCCTAGGGAAGCCAGCCCCAGGA
CAACCTAGGTTCTGCCCAGAAAGGGGATTATGGTCCACTGTCTAGAGGGTCATGGTCTCT
TCCCTGGTCCACTGCACTGAAGGGGTGTGTAGGTAGTATGGTCCTTGTGAGGTTGGAAGG
AATAAAGGGCTCTAGCCCCCATGGGGGTGCAGATGGCCGATGACGGACTTGATGAAGTCA
GTTGTGGTGCTGTAGCCGCCCATGTCTCGAGTCCGCACCTACAACCACCACCGGCAAAGG
CCGTGGGGAAGAAGAGAAGAGAGCCCATGATGGGGGTGGGGCAGTCTGGCCCAGGGAATG
GAATCCAAGAAGGGGTAACAGAAGGCCAGAAAAAAGATGCAGTGCAGGAGGGACGGAAGA
AGGTGACCAGGTTTGGAGGAGCCCACTACTTGAGCCCTATCAGAGCTACGCTGCCAGGAC
AGGAGGACAGGCTGAGCATGAAGTGAGATAGAGTACCTTGGAGAAAGTAAGGTGAGATCA
AGTGGGAGGAAAGACACAAGACAATGGAGATGAGCATGTCCCCCCCCCCCCCCAGAGAGG
AGGAGAAGAGGAAAAGGCAAAACCAGAGACTTGGCCTGCCCACTAGCTCCCTCTGCTGCT
CCACCCCCAGAAAGAAAGCTGCAAATTCCCATTCAGATGGCCTGTGACAGGGTCAGTTGG
AGGAACAGGAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1158..1247, 1588..1702, 2912..3073, 3243..3441, 3952..4139, 4220..4260, 4263..4279, 4281..4294, 4297..4373, 4376..4476, 4844..4992, 5237..5358, 5546..5680, 6201..6572
1001..1003, 1158..1247, 1588..1702, 2912..3073, 3243..3441, 3952..4139, 4220..4260, 4263..4279, 4281..4294, 4297..4373, 4376..4476, 4844..4992, 5237..5358, 5546..5680, 6201..6569
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved