Tupaia_belangeri Locus ENSTBEG00000003734
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000003734
Tupaia_belangeri
ENSTBEG00000003734
GeneScaffold_5838
SNORA70
2185..2320
3770
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCCAGTCTATGGTCTGAACGTCTGACAGAGCGTCCATCCGCCCT
CGCGGGGACTCTATGGTTCGTACGCGCGAAGATAGGCCACCTATATAAGACAAGCGCAGG
CGTGTGAGCACCTCTTTGCCTCCGGCGCGGTAAGAATGGCTGTTGCTTGACTCGTGCCCT
TGCCTTTTCTCCCCTGTGCTTTGAAGCGTTCTCGTTTTCTGTTCTTACGTTGTCTTTTTC
GTTGCAGCCACCGAAGATCTTGGTGTCAGCCATGGGCCGCCGCCCCGCCCGGTGGTGAGT
GCTGAATCTTTGCAATTTCTTTTTGGGGAAAGGAAGGGAGAGAGAACTGCCTTCGGCCGC
TGGAAACAACCTCGGGTAGCCATCCTCTTGTTGCTATCTTGTCCTGAGATAGGACCTAGT
GTGTTTTCTCAGACCTTTTATTTTTAAGCTCGATTTTCTTTCCAAACTCTGCACTGCTTG
CCCCTTTTCGTTTTAGAAATGTCAGGTTGAGCACATAGGCTTGTGCTGGTCCAGGGTCGG
CCTGGAAGATACGCCCACCTTGCTTTCCCTCCTTGTCCCTTGAAAATTAGCCATGTTTTC
TGGCTCCTTATCCTCTACAGCCTTTGTGCGCAATCCCCAATCCCTGTCTTGTTTCCGGGC
GACGTGCTGTTCAAGCTTGCCGGATGCCAAGGGCAGTCTAGGAAAAGCGGGCCCAGCTGC
CCTGCAGGGGGCGCCGGGCACCATTCATTCGGCTCAATCCGGCGAGGAGCCACGTGTCCG
ATAGTCTTCAGTTGGGTGGTCTGAGGCACAACTGCTTTGACTAACTCAAGCACGTAGTGC
TCAGAGACCCTGGAAAGAGACTTTGTTTATTTAACAATGCTGGATTTACAGGAAGTTTGA
ATCTTGGAGGGGAAGCATTGGTTCTTGGTTTTTGGCTTGGGTGTCCTTTGCCACCTGTTA
GATCATATATGGCTTTAGAGGTTCCATCTTCCCAGCCGTCTGGTTCCTTAAGGAGGCACT
CGGTGTGACCAAGTTCTCTTTGTAAACCTGGGTTTCCCCTTCCCCCCACAGTTACCGGTA
CTGTAAGAACAAGCCGTACCCAAAGTCGCGCTTCTGCCGAGGTGTCCCAGGTAAGTAGCC
GCAGAGGGATTTACCAAAAAACTGATTCTGGCCTCGCCTACCCAGGGGCCCATGTTGTGA
CCTGCCCTCCTTCTCCCTCACCCCCCCCCCCCATACACACCTAACTGAGCCTTTTTCAGA
TGCCAAGATCCGCATCTTTGACCTGGGGCGGAAGAAGGCAAAAGTGGATGAATTCCCACT
CTGTGGCCACATGGTGTCAGATGAATATGAGCAGCTCTCGTCGGAGGGTGAGGCCAGATT
CTTAAACACCGTCTTCCCAGTCTTTCTTGTGTGCGTCCTCAGCCCAAGCCTGGACCAGAA
GTGCTGCACTGGAATTAACATTCATTAAGCATGAGCCTTTTTACAACTCTTCCAGCCCAC
ACCTGTCCCCAGAGAGCTGGGAAGGAGGACCAAGGTGATTCTGTACTACATCTCATTCTG
CCATCTCCCCCCCAGCCTTGGAGGCAGCTCGAATATGGGCAAACAAGTACATGGTGAAAA
GTTGTGGCAAAGATGGCTTTCATATCCGAGTGCGGCTCCACCCTTTCCACGTCATCCGCA
TCAACAAGATGTTGTCCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
ATAGTTGGCCAGCAGGTGGGTGGGTGGGAGCTGTCGGATGGGCCCATAGGCACCTTGCAC
ATCTCATTGCTTAGCAGGGGCTCCTCTGCAGCCAATTAAGCCGACTGTGCCCCTTTAACT
CATGGGGGCCCGGTGTGCAGTGGCTGCAAACAGCAGCCTCCTGGGTAGTGTATACAGCCT
GTTGTTTGTACGGGTTGATCTAAGGGACCTTGGAGACAGCCCTTCCCAGTGGATGTTTCT
GTTTCTGACCTTGTGCTGTTTCCAATCTAGGCTCCAGACAGGTATGAGGGGTGCCTTTGG
GAAGCCCCAGGGCACAGTAGCCAGGGTCCACATTGGCCAGGTTATTATGTCCATCCGTAC
CAAGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTCCGCAGGGCCAAGTTCAAGTTCCC
TGGTCGACAGAAGGTAAGCAGAGTTGTAACTCCTTTGCCCTCCCCCCACCACCCACCTTG
CCCCAGGTTTCCTGATTGAGTTCTTCCTATCTCTCTAGATCCACATCTCAAAGAAGTGGG
GCTTTACCAAGTTTAATGCTGATGAATTTGAAGATATGGTGGCTGAGAAGCGCCTCATCC
CCGATGGCTGTGGTGTCAAATACATCCCCAATCGTGGTCCCCTAGACAAGTGGCGAGCTT
TGCACTCCTGAGGGTTCATACTGTGCTGCCCCTTCCTTAATCACAGTTATCAATAAATCT
TCTGATATCCTACATCTGTATCTGGATTCTTGGGGCAGTGGGGAGCCCTATGGGAACCAT
GGAATCACTGCCCTTACAATTATTAAACAGATGGAGACCAGCAGATCCAAAGATTATTGA
TTATTGAGCAGGGATCAGCAGGTGGCACAGTAGTTAAGGCAGCTGGACTTCCATAAGCTG
ACCAGTTCGAATCCCAAACCTAGCAGCTTGCTTTCTCACTTTCCTTCTCCCTGTCTCTGG
TCAACTCAAAAAAAAAGACAAATAAAATTAAATAAATTTATTTTAAAATTAAAGATTATT
GAGCAGGAAGCAAGGCTAATGAGGACAAAGCCTACAGGGAAGGGACTTTGCATCAGTAGT
AGATTGGAAAGCATAATAGGCCTGAGGTGGGGAGAGAACCGGAGGCCGCATGTCCCTTAC
TAGCCTAGGCCTCTATTGGTGTTGCTTGCTTCCCAAACAAACTCCATGGTGATGGAGAAA
GGCCAGCCCCAGCCCAACGGAATGGGTAGAACTACATCAAGCAAGGCATGGTCCCAGCCA
TATGGTTTAAACACACCCAGGGTTGTCCATGTACTGCTAGGAGTTCTAGTGTTCAGGATC
CTGATCCTGTTTCCCAGTATTCAACCTTGACCCACTACCCTGGTCCTCACCGGTCAGCCC
TTTTGAAGCCTGTGTTCCCAGGGTCCTTCCGCCTTCTGTATCCCAGCTGGCATCAACCCT
GGGAGTTCTGTGTCCTGGTGCTCTTGACTTAAGGATCCCAGGTGTGAGAGCAGCTTGAAC
AGGCCAGAGAGCTGCACCTTTGGGCCTCCAAGGGACTGAAGGAACTCCAGGGACCTGGTT
CCAGAGCTGCCCTAACATGACCTGCCTTCTCAAGACACTTGTTAACCTCCTTGACCTGTG
GCCCCTGGCTCTTTCATAATCTTCATTGCCTTTTGACTTTTTAAATTCATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1048..1055, 1060..1062, 1371..1429, 1559..1666, 1875..2013, 2370..2532, 2618..2770
1001..1045, 1048..1055, 1060..1062, 1371..1429, 1559..1666, 1875..2013, 2370..2532, 2618..2767
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved