Tupaia_belangeri Locus PAICS
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri PAICS
Tupaia_belangeri
PAICS
GeneScaffold_5900
SNORA26
21627..21747
24053
GTTGTGGTGGCTGGAGGCCCCGCGCGAAACCCGTAAGGTGTCGCAGGACCTCAACCAGC
CGCTACCGCCGCACAAGCCTATCACTAGAGGATCAGGCAGAGTAGAACGAGTGTGCAGCC
GAGCAGGAGCCGCCTAAGGGCTAATCCAAGTAAACTCAAGCCTTACCAACTGGCCAGTTT
TAGGAGGGGTGAGCGGACCTGGAGAGGGAGAGGAAGAGCGCATCTAATGAGCACAGGGGC
TGGGAGGATGAGCAGGACAAGCTAATATCTAGGTGTCGCACGCGCACGTCTTGGCAACCT
GGTCGATGCCATCCTTAGGCAGGTAAGAGTCCGTTCTCCCTAGGGAGCTCAGGGGATCGC
TAACTCTGGCCGCGGGAAATGGCTAGGGAAGACACAGAAGCACGCCCCGCCACCCCCACT
CCTCACCCTGTTGCTCACCGGTGCTGCAGCCCCACGAGTCCCAGAGTGATCACATGCGGC
ACATCTAGCTGCGTGGGCCACTCTCCGGAGGCAATGCACCCGAACACGCCACATTCTTCT
CGGATCCCCAACTCCTCCAGCTCCATGTTGCAGCCAAAAGCACGTGGAGGGACCTGCCGC
CGCGGCCGAGGTCCAAGCACCAACCCGCTGTGGGTTCGGCCCGTATGCCCCCGAAGCTCG
CACTCTATACAGCAGCTTCCTTCCCCGCGGATCAAGCCTCGCTACTGCGGCGGCGCGTGC
TTCGCCTAGGTGGGCGTGACTAGGTCGTCCTTGGCCGCCTTGCCACGCCCTCCCAATTCC
ACCAATGAGAGCGAGCAAAGGGAGGGGCTCCACGACTGAGGGGAGGAGTCACGCAGCCCG
TGGGGTGGAGCTAATCTTCCCGCGGAGACGTCGTAAAAGCTAATGTGCCTCCACGTGGAA
ATCTCCGTTATTTTCCAGCACCCTAGACTGGGATGAAGAGAATAACGGAGGGGACGTCAT
TTCTGTCTCAAGAGATATAAAGTTTACACGCCCCTTTCCTCATGCTTTCCCCCGGCCGTC
ACGACTTGGGACGCTCCTACCTACGACCCGATTTCGCGGCGGACCGGGGGCTGGTCTGGA
AGAAAAGCGAGGTGAAATAGGGGCAGCCAGAGCTCGTCACTTTTCTCTCCTGGAACTGCG
CCATGCCCGAAAGTTGGACTCGAACTCTGCGCCTTGCAATAGCGGAAAGCCTGGGGAAAG
ACCTTTTCCGTCCTGGAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTAAAGGGAAGGCAGGTTAGGTGGCGCTGCTGTGAACACGTGATCCTAAAGTCTG
TCTTTGTTGTGTTATGTTTATTATGAAGTCTTACTTACTATCTGCCTTCCTCAGGCTATC
CCTTACAAGCAGGAACTAGGTCTCTTACTGCTGTGTCCTAAGTCTCTGGCACACGGATAC
ACTCAAACAGCGCTAATACTCCGAATGAATCAGTAGGTCTGAGATCATGAGTGATTTCTC
TCTGGAAATTTCCTTTTTTTTTTTTTTTTTAGAATAATTTATTATTTTTTTTGTTATTAT
TGTTTTTAAATTTGCCCAGAGAGAAAGGGTAAGTGATGAAGTAAGCTGCCAGGTCCAGGA
CTTGAACCCAGGTTGGCTATGTGGGAGTCCAGCATCTTAACCGCCCCACCACCTGCTGTC
CCCTCTCTTTGGAAATTCTATGTCCTTAAACTTCTATTATCTTTGATCTTCATCTAAATT
GTTCTTCCTAATGATCAGGATCAATTTCCCTAAAGGCTTTGTGACCAGCATCAAAATCCG
ATTCCTCTAGGTTCCTTTTTGCTGTGTCACAACTGATAGTGAAGAGAGAGGGTTAATTGA
GTGAGGGGCAGGGCAAAATTAAGAAATAACCGGGCAGGGGTGCAGTGGAGGTACTACCAC
ATATAGTAACTCGAAATTAAGAAACATCTGAATGAACTATCATTTTGCTGGCCATAGAAA
CAAAAGTCAGGAGATGGGACTGTCTTTTCCCCCTACAGGCTAGCTTAATATATTGTGAGT
GTGTATATGAAAATAGGAGAATAGTTACATTGATTAATTTTCATTCTTTTGTACTTCTCC
TGTGAAAGAATCAGATGGATAGTGAAAAGAGCACATGATTTAATATTAGAAGATTTAGAA
TTTTGTGATTCCTCCATTTCCTAACTGTATCACTCCAACCTTTTTTGAGTCTTAATTTCC
TAATCTCTGTATCATCTATAAAGATGACTTGATTTTTTTTGGAGAGGTTTTTGCTATAGG
ACATGTGTGCTCGCCAGAAAGACAGAGAGAGACAGAAAGCAAGAAATCACCCCCAGGGAG
ATGGTCACGCTGCAATCCCTTCTCCTCCATTCTCCTTTCGGGATCTTGGGTATGCACACG
CACACACACACGCCCGGCGTGAGTTTAAGCCACTGGATCCGGAACTTGAACCATGGGCAA
CTACATGGGAGTCTGACAACATAGCCATTACACCAGCTGCTGGTGCCAAGATGACTTGAT
TTTTAAGACTATTATTTAATTGCTCTGTTCACTGATTCATTAAATGATTTACTCTTCGAT
GTGCAGGAAATTTCTTCCTAACATCTGATCTATTTCCGTTTTATTTCCACAGTACTAAAC
ATTGGCAAAAAGCTCTATGAGGGAAAAACGAAAGAAGTCTATGAACTGTTAGATAGTCCA
GGGAAGGTGCTCCTGCAGTCCAAGGACCAGATTACAGCGGGTAATGCAGCTAGGAAGAAT
CACCTGGAAGGAAAAGCTGCAATTTCAAATAAAACTACGAGCTGTATTTTTCAGTTGTTA
CAGGAAGCAGGTAAGTGGCTCCTTCTCCTCCCCCTCTGTCTCCTGCACAGTGATCTCTCT
AATGGGATGTTGGCATTATTTGGATTAGCAACATCTTTGGGGGTGTCTTTCCAAGTAAGT
TCATTTAAATCAAACCCAGAAATCTTACATCTCACTATGATATTTTACTTTGTTTGAAAT
TAGTAGGGGTTTTTTTTCCAGCTTGCTACAGGCTGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGGTCACGC
TGCAATCCCTTCTCCTCCATTCTCCTTTCGGGATCTTGGTAATGCACACGCACACACACG
CCCGGCGTGAGTTTAAGCCACTGGATCCGGAACTTGAACCATGGGCAACTACATGGGAGT
CTGACAACATAGCCATTACACCAGCTGCTGGTGCCAAGATGACTTGATTTTTAAGACTAT
TATTTAATTGCTCTGTTCACTGATTCATTAAATGATTTACTCTTCGATGTGCAGGAAATT
TCTTCCTAACATCTGATCTATTTCCGTTTTATTTCCACAGTACTAAACATTGGCAAAAAG
CTCTATGAGGGAAAAACGAAAGAAGTCTATGAACTGTTAGATAGTCCAGGGAAGGTGCTC
CTGCAGTCCAAGGACCAGATTACAGCGGGTAATGCAGCTAGGAAGAATCACCTGGAAGGA
AAAGCTGCAATTTCAAATAAAACTACGAGCTGTATTTTTCAGTTGTTACAGGAAGCAGGT
AAGTGGCTCCTTCTCCTCCCCCTCTGTCTCCTGCACAGTGATCTCTCTAATGGGATGTTG
GCATTATTTGGATTAGCAACATCTTTGGGGGTGTCTTTCCAAGTAAGTTCATTTAAATCA
AACCCAGAAATCTTACATCTCACTATGATATTTTACTTTGTTTGAAATTAGTAGGGGTTT
TTTTTCCAGCTTGCTACAGGCTGTATATACTCGTCAGAGAAGTGGGGAGAGAGAGAGAGA
GAGAACGTCCCCAGGGAGGGTGGCCATGCTGCAGTCCCTTGTCCTCTCAGGATTTGGGTC
ACACACACTCTTGTGTCAGGTGTGATTCTTAAGCCACTAGGTCCAGGACTCCAATATGTG
GTCACCCACATGGTTTTAGCTATTGGGTATGTGCATTCAACAGAGACAGAGAGAGGTAAA
GTGAGAAACCACCCCTCAGGGGAGATGGCTGCACTGCAGTCCCTTCTTTATTATCTTGGA
ATTTGGGGCATGCACGCACGTGCACCTGGCGTGATTTTCAAACTGCTGAGTTTGGGACTT
GAACCATGGGGTCCAACTATGGAAAACCTTGTTTATGTGGAATCGTAAGTATTTGTACTT
TTGTATCTTTTGAAATTTGATCTTGATTTTTATTCATGATAGTGCACACATGCACACAAG
ACGTGAGAATGTCTCTCCATCAGAGTCTGGTTATTTGGTTATTGATCCCCTTTTCCCAGA
CCACTAGTTCATCTGTCCACCTGGTATGTTTCAGGTCAGCTGGGCTGGGGATCTGAACCA
TGGTTGGCCATGTGGCTTCTGGCACACTACCCTGCATCACAGAGGCTGGCAGTGTCTGTT
TTATTTCAGTTCACATAATGATGTTTTCAGATTCATACAGATTCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCTGGTGGCTTTCTCTCTCTTTTTGCATG
CTATCTCTCTTTGTTGAGTTCCTGTTTTTTTATGGTAAATTTTCTATAGTAATAAATAAA
AAAAAGGAAAGAAAGAAAATACTTGTCCTTCCTTTCTCCTTTCCCTCATTCAGATTATTA
TTAGAAAACTCAGATAAAGGGACCAGCAGATGGCATAATGGTGATGTTGCAGGACTTACA
AAGAAGCAACTATTGTTCCAGTTCGGGACCGGATAGGAAAAAAGGTCAACTACGTGGGAG
TCCAGCAACATAGCTATTATGCTAACTGCGGGTCCCTTCTTATTTATTTTTGAGAGAGTT
CTCTGTTAGAGAGTGTGTGTACCCACCAGAGAAAAAGTAGAAAGACAGAAAGTGAGAAAT
CATCCCCTAGGGAGGATGGCCACCCTGCAGTCCCTTCTCCATCTCCTCTCGGGACCTTGG
ACACACACACATACGCACGTGGCGTGAGTTTTAAGCTATCAGGTCCAGAACTCGCACAAT
AGTTGATTCTTTGTAAGTCCTGCAACATAACCATTATGCCATCTGCTGGTCCCTTTATCT
GAGTTTTCTAATAATAATCTGAATGAGAGAAAGGAGAAAGGAAGGACAAGTATTTTCTTT
CTTTCCTTTTTTTTATTTATTACTATTTTAAAATTTACTATAAGGGTACATGTGCTCACC
AAAGAGAGTTAGCAAGCAAGAATGAGAGAGAAAGCCACCAGATCTGGACCTCAAACTGCA
ATCAGCCATGTGGGAGTCCAGCCCCTTAACTACCATGCCTCCTACTGGCCCCAGACAAGT
TTTTTTTGTTTTTGTTTTTGTTTTTTTTTTAAGAGATTTTTGCTATAGGGCACTTGCGCT
CACACGAAAGACAGAGCAGAGAGACAGAAAGTGAGAAATCACCACCTAGGGGGTTGGCCA
CACTGCAGTCCCTTCTCCATTCTCCTCTCAGGATCTTGGGCACGCACATACACGCCTCTG
GTGTGAATTGAAGCCACCGGGTCCGGGACTCAAACCACAGTCGACTACATGGCAGTCCAG
CGACATAGCCATTATGCCAACTGCTGCCCCAGACAAGTATTTTCTTACTGCACTTGGCCA
GGTGGCTGCTGTGTTCCTGCTGCTGCCTATTGGATTCTTTGTCGAGGATTATTTCCTTCT
ATGTAGGGGAAATGACTATTCAGAACTTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNATCTTCATCTTCATCTTCATCAGGCTTTTGCTGCCATAGTCAACCCTAC
CGTTATGATGAGCCTTCAGCTAACCAACATGGGCAGGCCACCTGATGTGTACCCTTCAGC
TAGAGAATAAAACCCCTCATCCTCCAGATGGCTTTCTGCATTGCAGAGTTGCACTACTGC
TGGACCTAGGTAGAATATGAGAATCTCTTATCAGATCAGATTTAGAGAGATTAATAATTT
AGTGTCACTCGGATGTATTATGTGCTTTATGCAAAATTAGATACTGCAAAGGAAATACTC
AATAAGCATTTGTTGAATGAGTAATAAACTCTGAGACCCATGCCTCTAGTCCAGTAGATA
CTTTGCCATCTAATATTAAAATGAAATAACTTCCCTTTTTTGAGAATTATTGGGACCAGG
TCAGCAGGTGGCATGGTGGTTAAAGTCACTGGACTCCCACATGGCCAACCACAGTTCAAG
TCCCAAACCTGGTGGCTTGCTTTCTCACTTTCCCTCTCCCTCTCTCTTACTTTCTCTCAA
ATTCATTATTAGAAATTTATTTATTAATAATAATAAATTATAAATTTATTTATTTATAAT
AATAAATAAAACTTAAATAAAAAGTTAAAGAGAAAAATATTTATTGGGACCAGCAGATGG
TGTAGTGGTTATGTCAATGGATTCCCACGTGGTTGACCATGACTTGAGTCCTGAACCCAG
TAGCTTGAAACTCAGGCTGGGTGTGTATACTTATGTGCCTAATATCCTGAGAGGAGAAGG
GATTGTGGCATGTCCATTCCCCCAGGGGCTCATTTCTTGCTTTCTGTCTCTCTCTCTCTC
TCTCTCTCTCTGTCTCTCTGTCTGTCTGTCTGTCTGTCTTCCTGGTGAGCACACATGCCC
TGTAGCAAAAACATCTCCCAAAAAAAAGAGAGAATTATTTATTTTATTTATCTTTTTTAG
TTTTCTATAGGACATGTGCACTCGCTAGGGGGAGAGAGAGAAAGCAAGCTACCAGGTCTG
GCACTTGAACCATGGTCGGTCATTAATAAGTTTGTTTTCCTACTTCAACTTTCTCTAAAT
TTCATTTCTTTTTCGATAGAAGTTTTATTTTTGTTTTATTTTGTTTTCGTTTTTTTAGAA
TTATTTTATTTAAATTTATTTATTTATTTAAATTTGGCCAGAGAGAGAGAGAAAGCGAGA
AAACAAGTTTCCAGATCTGGGACCTAAACTGTGATCAGCCAATCCAGCATCCTTAACCAT
TATGCCACCTGCTGGTCCCCAAAGTTTTGTTTCTTATAAAAGTCAATTTATTCTGTATCC
AGTCTACCTTTTGTTCTTTTTCTTTTTTCTTTTTTCCAAGAGACTTGCTATTGGGTGCAT
GCACTCACTGGAGAGACAAAGACAGAAGGGAGAAATCACCCCCGGTGGGGATGGCCACTT
CACAGTCCCTTCTCCTCCATTCTCGGGAATTTAGGCACACACACACCTCGTATGAGTTTT
AAGCTGCCAGGTCCAGAGCTTGACTGCAGTCGACTATGTGGCAGTCCAGTGATGTAACCA
TTACACTTTCTGCTGGTTCCTCAGGTCTACCTTTTTAAATAAAATTTCTACGCCTTTTCA
AAAACTTTATTATCTCTATGCAGGTATCAAAACTGCTTTCACCAGAAAATGTGGGGAGAC
AGCTTTCATTGCACCCCAGTGTGAAATGATCCCAATTGAATGGGTTTGTAGGAGAATAGC
AACAGGTTCTTTTCTCAAGAGAAATCCTGGCGTCAAGGAAGGATATAAGTTTTACCCACC
TAAAGTGGAGCTGTTTTTTAAGGTAATTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGTAAGCCAAAAAAAAAAAATAACTGAAATCAGCTTGACTTAGGTCCGAA
GGAATAACAAAATGAACAGAATAAAGGTAGCAATATTAAGAAAGAGGATAATATTTATTT
AAATTATTTTAATTACTGTTGATATTTTTCTATTCTAATGCAGGAAACTTTCCTGTTAAT
GTCTCTTGTAAGTGGAAATACATACAATAAAGGGCATAGGATCAGTGGTTACGATTTTTC
ATAGGCTTTATTCAAATTGCTTTACTTTTCCCATCTTGGTATATGCTGTTAATCATAGAC
CCCTGCTTGAGAAGCAATGTCAGTGTGGCATTTTCAAAATTTAAAGTAGCTTTTGAAAGT
AGACAGAAAGAATTGCTTTGGATTAGAGGGTATTGTAAATAAAAATCATTTTAGAGGAGA
TGATTATTTGTGAGGAATTCGTGCTTGAGGAGGAAAGGACTTAGCTATAATTATGCGGCT
GTGATTTGTCCTCAGGACGATGCCAACAATGACCCGCAGTGGTCTGAGGAACAGCTGATT
GCTGCAAAATTCTGCTTCGCTGGACTTGAGATAGGCCAAACTGAAGTGGATATAATGAGT
CATGCCACCCAGGCTATCTTTGAAATACTGGAGAGATCCTGGTTGCCCCAGAACTGTACC
CTGGTTGATATGAAGGTACATAAAACAAGAATGTTTGAGAGTAAAGGTTATAACGGGAAA
AGTCTTTAGCAGTGTAATTGTGAAAACTTCTTTGGTGATACACTATTCCTAGATTGAATT
TGGAGTCGATGTAACCACCAAAGAAATTGTTCTTGCTGACGTTATTGATAACGATTCCTG
GAGACTGTGGCCATCGGGAGATCGAAGTCAGCAGAAAGACAAGCAGGTAGGTAATGGTTC
AGGTTTTTTATCCTTCGTGAGATCAGGCTGAGATAGAGGAGGAAGGAGAGGAAAGGAGAA
AGGCAGTTATCACTCCCTTTGATATGAAGCTGATTTGATAGCTATTTAGGGGTTTTTTTG
GGGGGGGGGGTTGCTATAGGACACGTGCACTTGCCAGAATGGGAGAGAGAGATAGATAGA
GAAGACAGAAAGCGAGAAATCACCCCGCCCCCCCGGGGAGGTGGCTACTCCACAATCCCC
TCTCCTCCATTCTCTCAGGATCTTGAGCATGCACGCACATGCGCCTGGCTTGAGTTTAAA
CCACCAGGTCCAGGACTCGAACCGTGGCCAACTACATGGGAATCCAGCGATGTAGCCATT
ACACCATCTGCTGGTCCCGATAGCTATTTAGTTTTAAAGATAAATATCTTTCATATTCTG
ACATAGGAATAACACTTTACATTTATGAAGCAGATTTCTCATTATTTTAGACTCAGCAGT
AGCGGTGAGTATAATTTTGTTTGGCAAAGAGTAAATATTTTCCTAATTTTATGAGTAAGT
AGTAGATCCAGGACTATACCCCAAGTCTTACGGATCCTATCAGACTTCATTTCTGCTTTT
TTCCTACGAAAAACAAAAATAGGACAAGATTCTATACTCAGCGTGTATGGAGTAGTTAGT
TGTAGTTGCTAGTGTAGAAAGCACTTACCCTTAGGTGAGAATGAAAGTACGCTTTGCTGC
TGAACATTCTCTGATTTGAGACATGAAACAAATCTGTAGACTAAGATATATTTTTCAGAT
CTGTCCCTTGCTATACAAACTTCTTAATCCCTACCTAGTTATCAGAAGCTCATAGTTTAA
AGTAGCAAGAAATATTTGTTTTCTAAATTTTCTCTTATTTTCTAGTGTTACCGTGACCTC
AAAGAAGTAACTCCTGAAAACCTCCAAATGGTAAAGAGAAACTTTGAGTGGGTTGCAGAA
AGAGTAGAGGTAAGCCTCATGTGGTAACCTTTGCTGTTAAGTGTTTTTCTTCTAAGAACA
TCTTGTTTCAAAAAGAAAAATGAGGGCAGCATAGTATGCTCATATTCTCCAGTGACCTTA
AAATAGAATACCTTCAGAAATGCATAAGCTGGACTGCCTTACCTGGTACACTGGAACTCC
CTGCTGTGCAGCTCCCAGGTTTCCTGTGGGGGGACCTGGAATCCTTAGCCACCCCTCCTC
TGCTGTGTCCAAATGTCTAGTCCACTCCTCCCAAGTTTCCTGTGGGGGGGATCTGGAATC
CTTAGCCACCCCTCGTCTGCTGTGTCCAAGTGTCAGTTCACTCCTCCCAAGTTTCCTATG
GGGGGATCTGGAATCCTTAGCCACCCCTTCACTGCTGTGAAACTCTACGTGACTTCAAAA
TGTCACTTTAAGATTTTTATTATTACAACCAGAATTCAAAGTTGAAGGTGGTTTGTGGTT
ACCAAAAGCCATAATCACCTTTTAGAACATTATTTTTGTGGGAATATATATATATATCTG
TGGTAATAGAGACTCATAACATGACCTTTAATTTGGCTCACATGCCTGAAAGACTTCATT
AAGGGCCAGCCGGTGATGTGGTGTTAAAAGGCTCCTGGATCCCACGTGCTGACTGCGTGG
TTGCAGTCCTGACAATGTGGCTTGAAAAACACGTCGGGCACGTGTGTCTACACCCAAAAT
TCCAGGGAGAATGGAGAAAGAACGGATTGTGGCATGGCCATACTCCTGGGCAGTGATTTC
TCATTTTCTTTCTCTCTCTCTCTCCCCCCCTGTCCTCCTGTCTTTCCAAAACATGTACAC
ACCCTGTAGAAAAAGAAAAAACAACTTCACTAGACAGAATGTGCTGAAGCTCTAGAATAA
GATACTTTATAGTTTCCTGATATTAATTGAAAGGCTTGAGTATTAGGACCAGCAGGTGGT
GTGGTGGTTAAGGCGCTGGACACTCCCACATGGCTAACCATGATTCAAGACCTGGACCTG
GTGACTTGCTTTTTCACTTTCCCTCCCTCTCTGTGTATCTCTCTCTGGTCAAATTAAAAA
TAAATGAATGAATGAATAAATAAGTTTTTATTTTTCTTTAAAGGCTTGTATATTTATCCT
TGATTTTCATTATATCAGGAAACAATTTATCTGATTTTTTAAATTTATGTTTTAGATCTT
GCTTGGGAAGGATGTATTCCCTTATACGGAGGTTACTTTTTAAAATAAATTCCCTATAAT
TTTATTCTTTTTGCTTCTCTTGTAACTTTAGTCTATTAAGAAAGAATGATTCTGGAGATC
AAGCAGATGGTGTAATGGTTATGTTGCTGGGCTCCCACATAGTTTCGAGTCCTGGACCCA
GCAGCTTATAGCTCACACCGGGTGTGTACGTGCTCAAAATCCTGAGAGAAGAAAGGAAGA
GAAAGGATTGCAGTGTTCCTACCCCACCCCCAGAGGGGAGGGGGTGTCGATACCTTGTTT
TCTGTCTCTCCAGCTAGCACACTCTTTCTAACAAAAATCTCTTAAAAAAGAAAGAACAAT
TCTGTCCATATGTAATTTTACTATTACAAACTACAGCTCTGTAAACTGACAGTTGTTACG
GTGCTCATTTCTATGTTTATCTGTTTTTGTCTTTACATTCTTTTTCACACCTATGTTTTT
CTTTTCTAGTTGCTTCTGAAATCAGAAAGTCAATGCAGGGTTGTAGTATTGATGGGCTCA
ACTTCTGATCTTGGTCACTGTGAAAAAATCAGGAAAGCATGTGGAAATTTTGGCATTCCC
TGTGAACTCCGGGTAACATCTGCCCACAAAGGGCCAGATGAAACTCTGAGGATTAAAGCT
GAGTATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCTTCCCC
CATCAGTTACAGGGGCCTGGGTTTAAATGGCAGATCCTTTCAGGTATCTTTCATGGCCAG
CCTTTCTTGGGAGTCAGTCAAGTAGAAAATTAAGGAATAATTTCAATATTTAGTACATAG
AAGGATGAAGATAGCATTGATTTAAAATAACAAAGCCCTGGGTTCACAAACAAATGTTTC
CCAACTGGAAAAAAACGTTCATTTAGATATTCCCTCTAAAGGTAATTGATACAGGAGCAT
ACTTCCTCATTTTGGAAGAAGAATTGGGTAGGCAGGATGCCTCCGACCCGTTTGATAAGC
TAAAGAAAAGTAGAACTGCTAGGGATCAGGTCAGCACATGGTGTGATGGTTAAGGCACTG
GACTCCTACATGACTATCTGTGGTTCAAGTCCCAGATTTGATGGCTTACTTTCTCACCTT
TTCCCTCTGTCAAGCATGTATGCCCTATAGGAAATTAAAAATAATAATCATTAATTTAAT
TAAGTATTTATAACCTTTTTTAAATTTTAAAAAGGAAAGGTAGAACTCTTTCTCCAGAAA
AATACCAATATGTAAAATTTTGGATTGTAGGTTACAAATCTCTCCTTTAGGAAACAGGAA
TAACTTAAAAGTTTTATCAAAAGAATGAACTGTAAGAGCCATGCTTAAAGATAAATTGAA
GGGTCTTAAAACATGTGAGTACTCTGTTTCATGGGGTGGGTAGGGAAGTGGTTCTTGTTT
GTTTGTTTGGCAGGATCTGGCCATGTGATGGTCTTTCTGCCCCAGCCTCCCAGTTAGATC
GGTGGCAGGCAGGCACCTCTGCTTTGATGGGTTTGGGAATTGAACCTGGACCTCCTGTGT
TGCCCAGTCTCACACAGCAACACCCTGCCAATTATGTCACTGTGGCTGGGCCTCAATACT
ATGTTATTAAACTTGTTTTCAACTCTTGTTTCAAGAAATGCCCCTAGACAGCTAGGCTTT
ATTAACTGGTCTTTCTATTCCCCATTGGTTACCAGAACACGCAACAGGCAAGACTTCTGT
TTGGTTATTGTCACCCTTCATTTCACTGAGCTTGTGCAGCAGCTGTGGAAGAAACCTGTG
AGCCAATCCCTCACTGCCACCTTACTATCACCTTCATCTGTATACCTGTCCTATGACTTC
ATTACTTGACTTGTGGAAAGTGGCAGAGTGAACTTATATTTTGCATGTACATTTAATAAT
AGTGTCTTATTTTTGGATTTTCCAGAGAACACTCAAGAAATTAAGACATAGAGGCCATAT
TTTTTTTTTAATTATCTTATTGAATTTTATTTACTTTTTTAAATTTGACCAGAGTGGGAT
AGGGAGAAAAAGAAAGTAAGAAAGCAAACCACCAGGTACAGGACTCGAACTGTAGTCAGC
CATGTGGGAGTCCAGCACCCTTAACCACCTACCACCTGCCAGCCCCAGGCCTTACTTTCT
GTTAACTAATTTTAAAATCTGATAATCATCGTAATTTCCCAGGGGATGGCATTCCTACGG
TGTTTGTGGCAGTGGCTGGCAGAAGCAATGGCTTAGGACCAGTGATGTCCGGTAATACTG
CATATCCAGTTATCAACTGCCCTCCCCTCACACCAGACTGGGGAGCTCAGGACGTGTGGT
CTTCTCTTCGACTACCCAGTGGTAAGTTAAGCTGAGTTTTTTTTAAAAAAAAACTATTCC
AAACATTTCAGTGATTCACAGTAGTACCAAAAATAGGGAAGCGAAATCTACATACCTGTT
ACCTAACTCCTGCAATTTGCATCTTAACTGGAACTATGGCCCCCCTCCTTCAGGATTGTT
TTAAAGCAGATCTTTGCTACTCGAGTATTTTATACTTGAATATTTAAGTATGCATTTCTG
TGATAAGGACTCTAGTTTCTAAATCATAGTTTTGATAATACCATATTCAGACCTAAGGAA
TCTTTCTTTTCTTTCTTTTTTTTTTTTTTTTTCCATAAGGCATTAGTGCTTTCAAGAATG
ACAAAGAAAGGGAAGATGAAAAATCACCCCCCAGGAGGGATGGCCAAACCACCTTTCCTT
TTCCATTCTTCTCTTGGGACTTTGGGCATGCAAACTCATGTGCCTGGCTTACAAGCTGCC
AGGTCCAGGATTCAAACCACAGAATTGGCCACGTGGGATCCAGCTGCTTTAACCCCTATG
CCACCTGGCTGGCCCTGTATTTAGTGTATTTAAGTGAATATGATTATGTTACTGAAAGAA
AATCTTTTAGAAATTAAGTATCAAAATAACACAAAAGGAAGTCATATCTATTGATGGTTG
GAGCTGGATCGCTTAGAATAATGGTACTGTGTTTTGGTCCTCATAGTCCAAGATATGATC
TCACCTTCGGCAGGTCTTAAGAATCGATATTATCCAGTAGGAGTTGATTTGCTTATTATT
AGAACCCCAGATTTTTCTCACAGTTGCGTAAATCCACTGTTGACATGTGTCAGGTACATG
AAGTATTTGAGCCCACCAGCCTGGTTCAGTATAACTGGCTTTCTACCTATGCCTGCCACA
TGGCTGTGGTCTTAGAGTCACCCTTTACGACAGTTTCCAAGGTTCGTTTGCCTCTGTATC
TCGTATGTCCTATTTCTTAGGTCTCACATTGTCCCCTTTCTTGGTTCACTTATTTTGTTC
GAGGACATTCTTTGTTGACTTTCTGAGAACTAGATTTCTAGGTTGAAAAATCACTTTTTC
TCAGAATTTTGAAAGCATTATTGTCTTTTAGCATTCCAGAGTTGGTGAAAAGTCTGGCTC
CTTTCCACCATTCTGACTCTAGGTCCTTTCTGAATTTTTTCTTTCTGGGAACTTTTAGAG
TCTTTTCTCTGTTCTCAGTGTTCTTAAATTTCACCCAGATGTGAGTTGATGGCTGTTGTC
ATGGACTTTCAGTGGGTACCTTTAATGTGGCGTTCCATTTCCTTACTCCTGGGGGATCAT
CTTTAATTATGGCATTTCTTTACCTTTCCATTTTCTCTTTCTCTCATTTTTTGATTTATT
ATTCATCTTTGGATCCCATGATTTCTATTTTCGTTCTCGTTGCTGTACTTTCTGGAATAC
TATATGCTATGTGCTGAGCAAAAATTTGGCTGTTTTTCTCTACTTCTGTTGAAGGAGAGA
GAATCCGAAGATTTGTATGTTCTGATCACTGGTATTGGGAATACTCTTTTGAGAAACAAT
TATACCATGGCCTGTGTAAGATCCTGAAAAAGTCTTGTTTCTCTTTTTTTGATTCCATGC
TCACTAGCTAACCTACATTTTTAATATCAGTTAAGCTCTTCTAATGTCAGAAAAGGGGTC
CTGGGCAGTAGGCACAGGTATTTCAAGTGTTCTAGTGGAACAAGCCCCTCAGTATGCTAG
TAATAATGGTTGGCATTCAATCTATTAAGTTGACAGCGTATTTGTATACTAGTCTGTGTT
GTGGATAGTGAGAGAAAAAGAGCCTGGTGAATTCTAAGAGTACTGGGAAAATGGAGCTCT
GGGATCTGTGAGCCAGCGAGTCCTGGACTCGTGATCCTAGACATGCTAGTACTATCTCAG
AGACCACCTGGACATACACCCCTTCTCGTGCCCTTCTAAGGCTGCCGCAGTGCTTTAAGA
GTCTAACATAGAAGGTTAAAAGCAAGACTCCATAAAACTCAGAGAAGAGACTGTAAAACT
CCTCTGGAACCTGTCTGGAGTCACAACTGAAAGAAAAAAAGAAATTACCTAAGCAGATGT
GTGACCCCCAAGGGTGCTACTTTTTTAGTCTATTGCCTTTCAATAGACTATTGAATTTAT
TTATAACTCAGCATACTAAAATTGTAATTCTGATCTCTTGCAAGTGCACACACCCTATGG
TAAAAGCCTGCTTAAAAGGTTATAATAGTTTGTGCAAAGACAAATCAAAACAATATACCT
GAAGTTATTTTAAAACACGTGCTTCTCTCTCAACTTGATACTATTTATTTGTGTATGTAT
TGGAGAGGTTTTTGCTATAGGGCATGCGTGCTCACCAGAAAGACAGAGACAGAAAGCGAG
AAATCACCCCTGGGGGGATGGCCACGCTGCAATCCCCTCTCTGTTCTTGGGATCTAGGGC
ACACAGGCATGTGCACCCGGCGTGAGATTAAGCCACCAGGTCTGGGACTGGAACCATGGT
CGACTACATGGGAGTCCAGTAACGTAGCCATTCCCCAGATACTTTTTTTTTTTAATTTGT
TACACTTTTTTTTTTTTCAGGTTTTTGCCATAGTGTGCATGCACTCGCCAGACAGACTGA
GAGAGGGAAAGTGAGGCATTATCCTCCAGGGGGGATAGTAATCTCCATTCTTCTCGGGAT
TTGGGGCACACAAGCCCAGTATGATTTGCAAGCCACTGAGTCTGGGACTAGAACTGTAAT
TGGCCATCCCTAATTCGTCGTGTCGGAGTGCAGCACCTTAACCACCATGTCATCTGCTTG
CCCCTCTTGTTTCACATTTTAACTTTTACTACTTTATTTACTTCTGTTGTTTGACTTCTG
TCATAAGAATTTAAATGGATAACATAATGTGAAAAGAGTTTTTAAAAGGTAAACAACTTT
GCAGTGGATTTATTGTGCAAGGTGATAAGATGATGTATATAAGAAATTATTTATCATGGC
AGATAAATAAGTAACTGCTTTGTCTTAGAATAACTTTTCTAGCAGTAAAGAAAATTCTTG
CACAGATCCTACTTTGGCAAGGATAATATGGTAACCTTTTACTGTCTGGAGCTAAAAGGC
TTTCTCTGAGTTTAAAATGCCTTGCAAAGTTGTATTTGCATTACTAAATGACAGCTCAAT
TTTCTGTTTTCTTTTCTGAACTAATAGGACTCGGCTGTTCAACCATACTTTCTCCAGAAG
GATCAGCTCAGTTTGCGGCTCAGATATTCGGATTAAACAACCACCTGGTATGGGGCAAGC
TGCGAGCAAGCATATTGAACACCTGGATTTCCTTGAAGCAGGCTGACAAGAAAATCAGAG
AATGTAATTTATAAGGAAGAACATCATCACAATTCTTGGGGCGAATATAAATTTCTAGTT
TAGCCAAAAAAAAAAAAAATCAAGCAAGATGAATCAATTTTTAAGTTGATCATAGTAATA
AAATTTACTAATTACATCTCTAGATTCATGGATTAGTAAATAATCATTCCTATTTATTAG
TATTTCCTTGTAGACAGTTAAATTACCATAAGGATATTTTAAAATTAATTTCTTACCATG
TAGGTAGGTAACCTATTGACAAAATATGTTTTGTAAATGCTGATCTTGACCTATTATGAA
GCTCTGAAATTATAACTTGACCTTTTCTGTATCTCACTAAGTTATAGAAAGTTAAAATGA
TAGTATCTTAGAAAGAGTGTTAAGAACAGTGTAGTCTCTTCTACTTTATGGTCTCTATGA
AATTCCAAGAGTATGTTCTTTTATTTGTAGTCACTATTTCAGAAGATGATGTGTATTTAT
GTGTAGATTTGTTTTGTTTTGCTTTTTAAGAAATGCTGAGATTTGTGCTGGCAGACAATG
AAGTGAGTTGGACGGGCCCCATGGAAGCCATGGAAAGGCTTTGGAAACCTTCTCTGATAG
GTGTCAGGGCAACTTGGAGTGGGTAAAAATAAGAGTCATCTTTTCCATCTCAAAGATTTA
TGAAATCTTCGGCTGTGTAACTTGGTATAGAGGGTGTCCCTGTGAATCATAAACACTTTT
CAGTTCTGATAATACATATTTTAGCCACACCAACTTGCCATCATTTTCAGGAAGTGAAAT
CACAACTAGTTTGTTTCTTTCCTTCCTTTTTTTTTGTGGGGGGGTGTTTTTTATTTTGTT
TTTTTTTTCTTCTATGAATGAGACAGAGAGAAGATCCACCTGGTTCTTCATGCCACAGTC
CACCCCCATCATCAGCCTTAGAACATGAGCATGTGAGCATCAACATGTTCAGAGAGGTCT
CTGGACACAAACTCAGAATCTTCTGTTAATAGTTTGGATGATGTCTTTTCCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1027, 2080..2146, 9820..10017, 13943..14121, 14715..14894, 14992..15105, 16005..16088, 17769..17949, 19542..19700, 22887..23053
1001..1027, 2080..2146, 9820..10017, 13943..14121, 14715..14894, 14992..15105, 16005..16088, 17769..17949, 19542..19700, 22887..23050
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved