Tupaia_belangeri Locus C17orf45
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri C17orf45
Tupaia_belangeri
C17orf45
GeneScaffold_6028
SNORD49
1340..1407
2524
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCAAAAGAGCAATCAGCAGCTCACACAGAGAAACTGAAA
AACGGATCAACCGTCGCACACCGTTGGGGAGCAGCTGGGTGGGGACCCATGCCGCGCAGC
CCGGCGCGAGCAGCCCGCGCAGCGGCAGTCGCGCAGGCGCCCTGGAAACCCGCCGCGGGC
TCGAAGACCCAGAATCCCCTGGGCCGTGGAAGAGACCACGGCTCAGTAGGAGGGGGGCGC
CGTTGCTAGTGCGGCCGCTCTACCTCTGTAAGTGGGCGGGCATTCCGGTGAGTCTGCGCC
TGCGTCCCCTCCCTCTGTGAAGAATGGGATGTCCCAACTCCTTAAGGGCTTGGGGCGGCG
GAGGTGCCACCTTTCCGCCGTAGCTGACATGCAGGTGTGTGGCTTCTGTGTCTGGGACCC
TGCAGGGACAACTAAAGAGCGAGAGTCTGATTTCCTGGAATCCGTTTCCGGGAGGCCGAA
CTGCACGGCGCGGGGCGGTGCGGTAACGGCCTGGCTTCCCGGCCACGGCGCCCACGTGGG
CTTGGCGGGCGCGATGGCGGGGCGTTCGGGAGTCCCGCAGCGCCGCTCTGGGCGGGTCCG
GCCGCCCTGGGCCGAGCTCACGGGCCGCGGCTGTGTTTGTCCTGCAGGGCCACCGCCGCA
CGAGCTTGAGGTCCGCGAGGGCCGGGGCTCTACTTCCCGGCCCGCCTTGGAGAGAACTCA
GACCCAGAAAGATTTGGTAAGGCCGGGTCAGCCTGCGCTTTGGGTACCCACGTGGGAGGA
CCGTAACGGGCCTAGGAGGGAGACTGGATGACAGTAGTGTTAGGAAGTGCCGTCAGGAGC
GGAAACTGACGTTTATGCTTTTCTGATCGCAGTCTTGAGACTAAAACAGTTATACAATCG
GCTCTGAATTCTTGTCTTTATTTCCCAGGTTTCAGATGGCTGACTCACTGAAAGGTGTTG
AAGACAGGAGCAGCGCCCTGCCATGAGGTTCAGGTCTTGTCTAGGTGGGGTTTAATATAT
GTAACTTGTTATAACTTTGTAATTGTAAAGTTATAATTTTGTAATTAGAGGGGTTGTAAT
TTTGTTCTTTTAAATACACAGGAAGTGATTTGCAGGTGTTGGTTTTATGTACTTTATAAT
GTGGAACTGCAGGTACGACCAAGACCTGGGGAGCGCTCCAGCCATATCCCTAACATACAA
CCGACTTAAACCAAAGCTGCGCTCAGAAGCCAACCTTTTCGTTGGAAAATGTTTGCGGTG
GCTGGTGTGAAGGCAGTTTTAGCTTAGTGTCAGGTGACCTCCAGCTCTCTGGTTGGGCTG
GACAGTGCGAGTGCTTGACTGCTCTGATGAAATCACTAATAGGAAGTGCCGTCAGAAGCG
ATAACTGACGATAACTACTCCTGGCTGATGCAGTCANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1036, 1039..1131, 1134..1205, 1209..1251, 1253..1275, 1475..1508, 1517..1524
1001..1036, 1039..1131, 1134..1205, 1209..1251, 1253..1275, 1475..1508, 1517..1524
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved