Tupaia_belangeri Locus RABGGTB
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri RABGGTB
Tupaia_belangeri
RABGGTB
GeneScaffold_5807
SNORD45, SNORD45
1171..1254, 2921..2990
8847
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTAATTTCTT
AGTGCCTTTCAAAAAGCTGGGGCCGGTAATGTGTATTATTTTATGTATTTTAAAATTTTG
GCTCACATTTTTAAAGGTTATTAGCAATTCGATCTCGTGCAGAGACTTAGTAAAATTTTA
AATGGGATCAAAAAGAAAATCTCTACGTTTTTGTCAGTCGTTATGATCTACTTGTCTGCA
ATGCAGTCTCAATCACAAACGTCCAGGCTCGTTGATGAATGCGAAAAGTTAAAAGTCGTT
GGACCTAGAAGAAAACTTCCTTGGTAACTAGACGTAGTTTTGGGGTGCATAAAAGATCCT
TAAGAACCTAGATTTGATTAAGTAGGGATCTGGCTGCAAATTAAGGGCCTGCAGGATTTT
TAAAAATGTTTTTGTTTTTGCATGCCGTATGCCACGTGTGAACTGTAAGTTGTCCTGAAT
CCTAAGTTTTGGTAGTTAACTCTTTAAGTAGGAGATAAGCTGTAACAGATGCAGGTAGTA
CTTTTTTGGGTCGATGATGAGTTGGCATGTATTCTGAATTTAAAGTTGATTATTACTATT
TTAGCTCTAGAATTACTCTGAGACCTGAAAAATAACTGAATTGTGACTAAGAGGGATCTC
TAATGTTTTAAAGTTCTTTTTTGTTATATGCTTAAGTACTTCTGTGGCATCTTCTGTTTT
ACAGTGGTAAACTTGAAATTACTGTCTTTTTATCTTGTAAGGGCACACAGCAGAAGGATG
TTGTTATCAAGGCAGATGCACCAGACACTCTGTTATTGGAGAAACATGCTGATTATATTG
CATCCTATGGCTCAAAGAAAGATGATTATGTATGTATGATTTCTTGTTAGAAGTTTAAAT
TTTTGTTTTTGTAGTTGGGGTAATGTTTCAAGGTCAATGATGTGTTGGCATGTATTACCT
GAATTTACTCCTGATGTGTAATGAAACATTAGCTCTAGAATTACGCTGAGACTTTGAAAA
GTTTTACCCCAAGTTCTTTTTTTGGGGGGAGAGGGATTTCTTTTTTTTTTTTTTTTTTTT
TGCCATAGGGCGTGTGCACTCGCCAGACAGAGACAGAAAGCGAGAAGAGAAATCACCCCC
CAGAAGGATGGCCACACCACAATCCCTTCTCCGTTCTCTCAGGTTCTTGGGCACGCTTGC
AAACATGCCCAGCGAGAGTTCTAAGCCACCGAGTTGAGACAGGAACCTTGGTCGACTAAA
TGGTAGTCCTGCGACATAGCCGTTAAGCTAACTGCTAGTCCCTACCCCAAGTTCTTAAAA
GAGTAGATTTTGCTCTCTGGGACATCTTAGCAAAAGTAGTGTCTCAGAACATATCTTTTT
CTCTTATCCAAACATTTGGATTATCTTCATTTTATTACCATTTAGGAAAGGATCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGGAGTTCAGGAGATAGGTACTT
TTTCCCTGGCAGACTTAAAGGTTTGACTACTCCTCATTTTACGTCTTGTCCACCAGCCTC
TATTCTAAACCTTGATTTGAATTGGCTGCAAACCAAGATATTCACTAGATTGAACTGCAG
CAAAAGGGCCCAACATGGTGAACGTGTTGGATCCCATATTGCCGACTAACATGCTTGACC
CAAACTGGTGACTTGGAAGTATGCCAGGTGCATGTGTGCTCAAAATCCCAAGAGGAGAAA
AGAAATTGTGGCATGGCCATCCCTCTCTAAGGAGGAATTTCTGACTTCTCTCTCCTGTGG
GGAGCATGCACATTATGGCAAAAATCTTAAAAAGAAAAAAAAAAAGTTTGTTTCTGGAAT
CTTCCTATTTTCATGTCTCCTTGATCAGGCACCGTTTTATCTGAGCATAAACACCTACTT
TTACATGCTTACATTTTGATTTTTATGTAGTCACATCATTTATTAAAATGTGAAAGGTTT
GGTAATGGTGTTCCTGTATTAAAAGAATCGATATAAACACAATACAGGCACTGAAACAAT
ATTCTACCCAAACTTTATTGATGGAAAGAAAAATAGCTTTTTTTTCTGAGTTACCTTACA
TCTCTGCTCTTGGGAGGAGCCCTATTTATAGTATCAGTCACAGATAAACATACATACTAG
TCAGATAAATTATTTCTGATTAATTTTGCCTGAAAATAGCTCCTAATAAGTTAAAACATA
AATTTAAGTTTACTGTTAATTAGCGATGCTGTTAGGCTGTCATGTTAACTTTGTTTTTAA
TCTAACCCAGTAAATTCTGATACTTAAGAATTGTGTATTTTAGGAGTACTGTATGTCTGA
GTATTTGAGAATGAGTGGCATCTACTGGGGTCTGACAGTAATGGATCTCATGGGACAACT
TCATCGCATGAATAGAGAAGAAATTCTAGCGTTTATTAAGTCATGCCAACATGAATGTGG
TGGAATAAGTGCTAGTATTGGACACGATCCTCATCTTCTATACACACTCAGTGCTGTCCA
GGTAAATACTAATTAAAACTCCATTGTCTTGATAGTATATTGAAACTATTAGGAAGATTA
CAAACGTCAGTAACTGATACTAAAAATTAAAAGCCCTATAAGGTCAGTGATGTGATGGCA
TGTATTAGCTGAATCCAAAGTTGATGTGAATTTTAAAATTACTGAGACCTTGTGGGGTGA
AATTAGAAGTTTCGTTGAGTTGTATATTGTATAGTATTCGTAAAAACCACCTGGCAGTTT
AAAAGTATTTCTATATGTGAAAGTATTTCGAATGCCAAGTTAAAATNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTGCTGACTCCCACATAGTCGACTGCAGTTCAAGTCCCGGACCGGTGGC
TTAAACTCACACTGGGCGCATGTGCGGTGTGTGCCCAAAATTCGAGAGGAGAACTGAGAC
GGGATTGCAGCGTGGCCATCTCCCTGGGGGGGTGATTTCTGGCTTTCTGTCTTTCTGGCA
AGCACACACGCCCTATAGCAAAAAAGAAACATGCCTTGTGCATGTGTCTGCCTGCCTAAG
ATCCCAAAAGGAGGGAGAAACGAAGCAGAGGAGATTGTGGAGAGACCATTACCCGCTGGG
GTTGCTTTTGCCTCTCTAGCCATTGCATGTGCCTTCTAACAAAGCAAACTGACTAGTCCT
TCAGATTCTTAAAGTTTTTGTTATTTGACTTTAGATTTAGTATTCCTCTTATGTACCTAA
ATTTATCTTGAACCATTAGAAATTTACTAGGGTAGTTGTATAGATTGTGCTTTTAGAGGG
TAGTTGTATAGATTGTGCTTTTAGATGACTTGGATGATGTAGTCAAATGTCTGATGTTTG
CTCTGGTATGGTTTTTTCATTTTAGGAGAAATTGATACAAGATTCTCTTTTTGTGCGGTG
GCGACTTTGGCTCTATTGGTAAGCTTTGAATACTGTGTTGAAATTATTAGATGACCATGA
TTATGCTGGAATTTAATAGTTGTATTTGTTTTGTTTAAAGGGGAAACTTGATGCTATCAA
TGTGGAAAAGGCAATTGAATTTGTTTTATCCTGTATGAACTTTGATGGTGGATTTGGTTG
CAGACCAGGTTCTGAATCTCATGCTGGGCAGGTAACTTAAGATAAGCACCAATTTTGAGG
AGATAACCAATGATTAAAAATGAGAAATCATACTCATAAAATTTAGTATTAATCTGAATG
AAGTTAGACTATAATGTGGCAAGTTGCTTATTTGCTAATTAAAGCATTTCACAATTTGCT
TTATTTATATACCTTCTTTCAGAGAATTTCTTCGACTCAGGTTCATAATCACCAAAGTAC
ATTTGTATTTGCCATAAAATTTTAATTAACTAGATACATGAAAACATTGCATTCCACTTT
GAGCTAAATGAGCACTACTTCATGTAGGCAAGAAAACATATATATATAATTGTGGAATAC
TTGGTCACAAAGGAATTTTGACAGTAGTATTTCAACTCAGAATTGGGTCCTGTTAATAGT
GATAGTATTGTATTATGGGCTTTTTGCATAATTCTGAGATTTAATGTGTTTGAAGTTCTA
AATGTTCAATTATTAGATCAGAAAGCAAACTTTAGATGTAAGTGGGGTTTTAATAATTTT
TCTATCACTTTTACTGTCAAGAAATTATTATACAAATGTACTTTATGTCTGTAATTTTAG
ATCTATTGTTGCACAGGATTCCTGGCTATTACTAGTCAGTTGCATCAAGTAAATTCTGAT
TTACTTGGTTGGTGGCTTTGTGAACGACAGTTACCTTCAGGTGGACTCAATGGACGACCA
GAAAAGGTACTTACTGTTGGCTAAACTGTTTCATTAGCTCTGCAATCTTAGTGCTACTTC
TTTGTCTTCCAATCTTTAGTTTTGCTCTTGAAAACTGGCCATGAGTTTGTTTTTTTGAGA
GGTTTTTGCTATAGGGTGCACGCACTCGCCAGAGAGACAGAAAGCGAGAAATCACCCCCC
CCCCAGAGGGGATGGCCACTCCCCAGCACCTTGTCCTCCATTCTCCTTTTAGATCTTGGG
CATGCATGCGCATGCACCCGGCAGCATGACTTTAAGCCATCCAGTCTGAGATTTGAACCG
CAGTCAACTGTGTGGGATTACATCGACATAGCTATTATGCCAACTGCTGGTCCCTAATTT
TTTTTTTTTTTAACCTGACTTTATTGTAATTTTTCAGTAATATCCTATAAAAGGACTTTG
GTAGAAGTAGAACCTACTTTGTTAAAGTACTATGGGCCCCTGTGTCCATTTTCAATAGGC
TTAAAGAAAACATACAGTTTACCATCTAATGGCACTTTTTACAACAAATTTCACATTCTG
AAATTAATTGTTGTGTTACTTACAGGAGAATACAAAACTATTAAATACTCATAGTTCAAA
GTATTTGTGTTGAGACATAGTAAATTTTTTTTTTTGAGAGAGAGAGATTTTTGCTATCGG
GTGTGTATGCTAGCCGGAGAGACGAGACAGAAAGTGAGAAGTCACCCCCCTAGGGGGGAT
GGCCATGTCACAATCCCTTCTCCAATCTCCTCTTGGGATTTTGGTCACACAAACCACAGT
TGACTCTGGGAGTTAAGCGTTGTAACCATTTCACCATCTGCTGGTCCAGAGACATTGTAT
AAATTTTGGAAGTTTTTTTTTCCCTCATTTTCTGAAGGCCTTGGATTTTTTCAAGCATTG
GAGTGAAGGTCTTTAAATATTTACATTCTGGACCTACGTTATGGTTATCCATCTTCTACA
GAATCTCCACTTTCATCTATTGGAGTGAATGGAGAGTTAATCTGGCTACATTAAAGGGAT
TTTTAAAGGGTTATTTTATTTGCTTTATTATTATTTTTTAACTTGACCAGAGAGAGTGAA
AGCGAGAAAGCAAACACCAAATCTGGGACTCAAACCATGGTTGGCCATGTGGGAATTCAG
TTAAATTAGGCTGTAACATTTTCATAAGCAACCATTTCAAGTACTGCATGTCAGTATAAC
TATCCTTTGATGTCCCTCACCCAATTTGATTATCAGGTTAAGAGTGAGAACTCAATTTTT
TTAAATTGATCTCAAAATGAGAGAAATAAAAGAATGGAGAATAAAATTGTGACAACTTTT
TGTGATCTTTTTCCTAGTTACCAGATGTATGCTATTCATGGTGGGTTTTGGCCTCCCTAA
AGATAATTGGAAGGCTGCATTGGATTGATAAAGAAAAATTGCGTAGTTTCATCTTAGCAT
GTCAAGATGAAGAAACGGGGGGATTTGCAGACAGACCAGGAGATATGGCAAGTATTGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTGCT
TCAGATTCAATATTTTTTAAACTTATTTTAAAATCCATAATGGATATAGAACCAATTTTC
AGAAATTTCTCATCAGTTGCTTACCAAATTAAGTGTATGGTGAAGGTCAGGTGTTAAAAA
TTTTAAAGCCTTAGTAAATAATAGACTTTTTAAATTTATTTCAAGTTTTCATTTTGTAAT
AAGTTAATGGATTCTTCTCTTAAACAGGTGGATCCTTTTCATACGTTATTTGGAATTGCT
GGATTGTCACTTTTGGGAGAAGAACAGATTAAACCTGTTAGTCCTGTTTTTTGCATGCCT
GAAGAAGTGCTTCGAAGGGTGAATGTTCAGCCTGAACTAGTGAGCTAGAGTCATTGATGC
AGCAGTTGCTGAGTGTGGTTTTGGCATCTCAACATTTCTGTATTTGAAGTGCTTACTGAA
TTTTAAAATGACTACTGTTAATATTTTGTACTGTATATTATTGTGTTAATTTTAATAAAT
TATATAATTATACATATTGTAAAGTAAGTATTATTTCTTGGCTTTAGACTTTCTTTAGAA
ATGCTGTTAATCTGAGTTCTGCTTGATCTTGTGTTTGTGTACACTTAACATGTTCTTTAA
CAATAGTTATTTAAACTGTTTTGTTGTCATTAAGTGATAAAAATGGGTAAGCACCATATA
TGAATTAAACAATGCACAAAATAAATGACTTTGTAATTTGGGAGTAATTTATGGATTTTA
ATAGTATTAATCTTGAGTTAGCCTCATGTTTACCTAAATGGCAACTTACTATCTTACAAT
GGATTAAAGTTTGGGGTGGCTTAATTTTCATTTTATAGGTCAGAACTATCTAAAGGGGAT
TAGCAGTTGGCGTAATGGCTGTGTCACTGGATTCCCATGTAATCGACCGCTGTCCTGACC
CAGTTGCTTTCTGGAGAGCCCATGCACCCTATAGCAAAAATCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 2623..2820, 3486..3591, 4525..4577, 4660..4770, 5340..5465, 6797..6950, 7662..7663, 7707..7847
1001..1108, 2623..2820, 3486..3591, 4525..4577, 4660..4770, 5340..5465, 6797..6950, 7662..7663, 7707..7844
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved