Tupaia_belangeri Locus TNPO2
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri TNPO2
Tupaia_belangeri
TNPO2
GeneScaffold_5945
SNORD41
1270..1339
6342
GATTTGAAAGCACCCTGGGGGTGGTTTCTCACTTTCTCTCTCACTGTCTCGTCTGGTGA
GCGCACACACCTTGTAGCAAAAAAAGTCTCTCTAAGGACCAGCAGTTAGTGTAATGGCTA
TGTCGCTGGAATCCCACATAGTTGATTGCGGTTCGTGTCCCGGACCCGGTGGATTAATAC
TCACACTGGGCGCGTGTGCGTGCGTGCCCAAGATCCCGAGAGGAGAATGGAGGAGAGGGG
ATTGCAGCATGGCCATCCTCCCTGGGGGCTGATTTCTTGCTTTCTGTCTCTGTTTCTCTC
TGTCTGTCTGGCGAGCGCACGTGCCCTATAGCAAAAACCTCTCCCCCCCCCAAAAAAAAA
AGTCTCTCTAAAAAGATAAAGATAACCCGACCTCCAAGATGAGGTGCATGGGCCCTGTTC
CCCTCTAGATCTTTTGCCAGCTCTCTGACATGCCTCTGGGCCAGTTTGTCCGGAGCCTGT
TCGTCCGTCTGTAAGGCAAGGCGGATGTAAGGATCGGGGGTGGCTGCCCCCAGCTGGGCT
CGGGGCGGTGCCCAGGCCCCAGCCCAGCTGTCGCCTCCTGTCTCCCGGTCGCTGCAGGCT
GCATGCAGGGCATGGTGCCCTACCTGCCCGAGCTGATCCCGCACCTCATCCAATGCCTGT
CGGACAAGAAGGCCCTGGTCCGCTCCATCGCCTGCTGGACGCTGAGCCGCTACGCCCACT
GGGTGGTCAGCCAGCCGCCCGACATGCACCTCAAGCCTCTCATGACCGAGCTGCTCAAGC
GTATCCTGGACGGGGAACAAGAGGGTGCAGGAGGCGGCCTGCAGGTGAGCCCTCATCCCC
GCTGCCGCCCAGCACCCTGCGCCCCTCCGGGGAAGTGATGACACTGTGACCGCTGACGTG
GCACTGATTTCTCTGGTATTCGTACTGGGCTGATCCCGAGCGCACCGTCCCCTGCTGCCC
GAGGCCTGGTACTGCTGGCTCTGGTCCCCTGAGATGCCCCTCCCTGCCCACAGTGCCTCG
CCACCCCTGGAGGAGGAAGGCCTGTACGGAGCTGGTGCCCTACCTCAGTTACATCCTGGA
CACCCTCGTCTTCCCCTTTCGGCAAGTACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
TGATTGGCTGTCAACCAGCCTCTTTTTCTCGGCGGTGAGGGGCCAAGTGGATGAAAGGCC
ATTTGTGATTGGCTTCCCCAGTGAAGCAGACTGGGACAGCTGTCCTGATTGGACTGTTGC
CCCCTCCAGGCCATTGACTGAAAGGCCCATTGGGATTGGTTAGGTGCTTTTCCCCAGGGA
GGCTGGGCTGTGGAGTCTGCCTGTGGGTCACCTTAGAGCCGGGCTGGCCAGTGCAGGGCC
CTGACTGGCTGGTCCTCCAGGGGCGGAGATGCAACCTTACGTACAGATGGTCCTCAACAA
CCTGGTGGAGATCATTAACCGGCCCAACACTCCCAAGACGCTGCTGGAAAACACAGGTGG
GCCAGATCTGGGCTGCCGCTGCCCGCCCTCCTGCCACCTGGAGGGGGGCTCTGGGCTGGG
ATGTGGGTTAGGTAAGGGCCTTGGTAAAAGCATAGAGAGCGGACCCGAGTGGGGGCCTGG
ATTCCCTAGGAAGAGATCCAGGTGGGGCTAAGGGTAGGGCCCTGGCCGGGTCAACCTCAG
GGGAGCCCAGATGGGTCGCAGGAGCCATACTCCTGGGGCCCCTGGGGCGGGGCTCGGCGC
CTAGTGCCCAAGGCCCCGCCATGTACCGTCCCAGGGCCGCTCGGGGTTGCAGGTCAACTG
ACGTGTCCTTCTGCCTGATTTCAGCCATCACCATCGGCCGCCTGGGCTACGTGTGCCCGC
AGGAGGTGGCTCCCATGCTGCAGCAGTTCATCCGGCCTTGGTGCGTGCCCTGCCGTGCTG
TCCCCGCCCCAGCTGCCTGGCTGCCGCTCTGCCTGCATGTACCCCCCACCCTGCAGGGCA
CCTGGATCCCCCACTGCCCGCGCGCCTCGACCTCCACAGGTGCACGTCGTGCCCTCTGAC
CCGCGGCCTGCCTTCCACAGGTGCACGTCCCTCCGTAACATCAGGGACAACGAAGAGAAG
GACTCGGCCTTCCGCGGCATCTGCATGATGATCGGCGTCAACCCCGGGGGCGTCGTGCAG
GTGGGGGCCGCTGGACTCTGAGCGGGGGCGCGGGGGCTGGGCTTGGGCCGCCCCTCTCAT
GGGATCCATCACGTTTCAGGACTTTATTTTCTTCTGCGACGCTGTAGCCTCCTGGGTGAG
CCCGAAGGATGACCTTCGGGACATGTTTTATAAGGTGAGGCTCCCGCTGGGTCCCACGAT
GGGGAAGTCGCCCTGCGGCTCTGCTCCGGCGGCCCCTCACCCCCGCGCCCCCGCGCCCCC
CTTCCCTCCGCACAGATTCTCCACGGCTTCAAAGGCCAAGTCGGGGAGGAGAACTGGCAA
CAGTTCTCAGAACAGTTCCCGCCGCTGCTCAAGGAGAGGCTGGCGGCCTTCTACGGGGTC
TAAGCGAACATGGAGACTGCCAGGTGATGAGTTCGTGGCCCGCACCAAGGGCCAAGGCTG
GCTGGGGCCCCGCGAGGCCACGCCCTGACTCTCCTCTTCCTCTTCCTCCCCTTGCAGATT
TCTGTCTGCGTCGTCGTCGGAGGGATTACTGGGGAGCCGCGCTGCGTCCAGAAGTCGCTG
GTGCCCTGATCGAGGGGGGGTTCGGAAGAGTGAGTGGGGACCCAAAATCCAGAACGCCTT
TCCCCGTCGGTCCGTCCGTCCCTCATGTTCACGCCCAGGCCTGATCTGACCGGCCAGGGG
GGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1192, 1194..1225, 1415..1437, 1439..1500, 1502..1588, 2505..2591, 2692..2799, 2900..3058, 3159..3246, 3347..3445, 4622..4717, 5014..5036, 5039..5121, 5282..5381, 5461..5535, 5637..5744
1001..1192, 1194..1225, 1415..1437, 1439..1500, 1502..1588, 2505..2591, 2692..2799, 2900..3058, 3159..3246, 3347..3445, 4622..4717, 5014..5036, 5039..5121, 5282..5381, 5461..5535, 5637..5741
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved