Tupaia_belangeri Locus ENSTBEG00000015847
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000015847
Tupaia_belangeri
ENSTBEG00000015847
GeneScaffold_4723
SNORD58
1115..1179
4683
AATTCTCATGAATTCTCCCAGGAGCCACCGCTCTTCCTCTTCTCCGTAGCGGCCTGAGG
TGAGTGTCTCTGTGGCGTTGCTCCGAGTGCTCAATCCTCCCGCCATCGTCACCATCCTGG
CCTGTGGGGCATCGGCCTCATGTTCTCCACGAGCAGAACTCCCCGAACTACGGATTCCTC
CTTAGAGGCAGTGGTCTCTTGGGCGGGAGGATGTAGCAGAGAGCCTGATTTGTCGCGCCG
TAGCTGGCCGGTTTCTGCGGCCCTCAGGCACGCGATGGGTGGGATTGGGTGGCAGGGCCC
TTTCGCAAGTGGGGACACGGTCGGCCAGCATTCCATGCCGATTCCGACTTCGGAGATCCA
GTGTCTCGCGGTGAGTGTTGGCCCAGTACGCGGCGCATTTGTGGCCTCAACGAGAGGCTT
TTGATGGGAATTCAAGTCGGGGCGAAGCGTCACTCGTTTTAACAGGACGGCTGTTAACGT
GGGTGATTGTCCATAGACTGCTGGGGCTGTGTGAGTGAAGGGGCGTTTTGTGGAGAGAGG
ACGTGGAGGCTTGCAGTTGAGTTCCGCCGTGCCCGTGCGTCAAAACACTCCCCGAAAATC
CAGGTTGCCTTGGGTCATAGCTGTGCTCCGATCGGGAGGGACGGGAGAGCCACTGTTCTG
TCACTGTCAGTAAGGACTGTAGTCGGTTCCATAGGGGGAGAAAACAGTGGCTGCGATGAT
GCATTTCTTAGGACACCTTTGGATTCATCATGAAAACAACTATTTTCTGAGCAGCTGTTG
GTAGCTTATAATACTTAAACTGTAATGGTTATTGTAAATATGGGTCATTAACAAAATCTT
GCTGCGCTTTCTCCCAGGTGATCTTTGAAAATGGTTCGCTATTCACTTGACCCAGAGAAC
CCCACAAAGTGTAAGTGAACAAGCCATTGATAAGTTTTATGTTGTGGGAGGTTAGCATAT
GAAGATACGCAGCATTAATCAAAATATTTTCATTTTTTAGCATGCAAGTCAAGAGGTTCA
AATCTTCGTGTTCACTTTAAGGTACGTGGATCCCAGTTGAGTTGTGATCTGAGAGTTCTT
CTACATGTTCCCTTCAGTGATACTCTAAAAGGTAGCTGCAATGATGCCATTCTTAGGACA
CCTTTGGATTTACCATGAAAAGTAATAAATTCTGAGCAGCTACATTGTACTTTGGCATTG
CATAGGGTCCAGTAAAATGACGGGAACTACTTGATCTGGTGTACAGAGCAAGATAGGACA
TGTAATTGCAGTGCAAGATAATGGAACTTTAATATTGCGTAGTGTGCATAAATGGAGGTT
TAGGTTTAATTTTGCCTGGCTTCAAACAAATTTACCCCAGCTCTTAGTCACAGAATTTTT
TTCATATTCTCTCACCTCTCAAACATTGTGTAAGGGGTTAACTCTTGGTATATATTGACT
TTGGGTGGGGGGAGATTTTCGCTATAGGGCGTGCGCTCGACAGACAGACAGACAGCGAGA
AATCACCCCCCCAGGGGGGATGGTCACACCGCAGTCCGCGGCCCTTCTCATCCATTCTCC
TCTCGGGATCTTGGGCACTCACGCATATGCGCCCAGCGGGAGTTTTAAGCCACCGGTCCA
GGTCCAGGACACAAACCCGCAGTCAACCACGAACCCGCAGTCAACCACGTGGGAGTCCAG
CGACATAGCCATTACGCTAATTGCTGGTTCCCTGTATTGACATTTTTGAAAATCTGAAAA
TGTTTACTTTTAAAATTCCAGTACTTTCACATGGTTAACCAATACTTCATTGTTACATTT
AGAACACTCGTGAAACTGCCCAGGCCATCAAGGGTATGCATATCCGAAAAGCCACCAAGT
ATCTGAAGGATGTCACTTTACAGAAGCAGTGTGTGCCATTCCGTCGTTACAATGGTGGAG
TTGGTAGATGTGCCCAGGTGAGAATTCTTAGTTGCCATTTAAAAAGACAAATTTTGAGAA
AGGGTGATTGGATGGGATAAAATGGCTAAGGTGAGCTTTTACCATCTTCAATGACAGTCT
TGGACACCTTTGGATTACACTAACAGGTATATACATTCAGACAACCTTGATAGTGAATAA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTTCTGTTGTCCAAAATCA
TAAGCTCGTTTGTCTGACTTTCACAGTAATTTATCTCTCATGTAAAGAAATTCTTAAAAG
TTTTTATACAGTCTGCAGCGGGCCATTATCTGTGTGTGTAGATTTCCGCGAGCGTGGTCT
GCAGTTCATCCAAACCTAAGCTCTATGCCTCCCTTCTCCCCAGTGCTGAGAAGTTGTGCT
CTTTTTGACGCTCTCCTTATTCTCGGGAGATGTTTTACCAAGGAGTATTTTTCCTTTCAT
GTGCTGTAGTATGTTTAATTATATACATGACTGTCTTAGTGCCTAAGGTGCTTTGTTGCG
TGCAGTCATAATACAAACATGTTTCAGAAATAAGTTAAAATAATGATATATTAGATAAAC
CTTGGAATTTCTTTATCTCTTTGCATTTGAAAGTCTGGGCCAGAATTGGAATTAATGGCT
CCTAGCTTCAATTCTGTTTATTACCAGGGCTTAGAAATTGGTAGTATGGTATCCATCAAC
CTCTTCAGCTCTTTTAAGTTTTTGCCATAGGGAGGGAGCGGGCACTCCCTGGAGAGAAGG
AGTGAGAAATCATCTCCTTGGGAGAAGGACACACATACACACACACATGATTTTCAAGCC
ACCAGGTCCTGGATTTGAACTGTGGTTGACCATATGAGAGTCCAGTGCCTTAACTATTAT
ACCACCTGATGGCCCCACCATCTTTTTATTATTTATTCATTTATTTTAATTTGATCAGAG
AGAGTGAGAACAAGCCACCAGGTCCTGGACTCGAACAGTAGTCGGCCATGTGGGGGTGTC
CAGCACCTCAACCACCACGCCACCTGCTGGCTCTCCATGAGCTCTTTTTAATGATTTTAG
GGCCGGCCACATAACAAACAGTGGAGTTTGCTGGTAACTTAGACACTTAAAGGTGAATGC
TGTTTGCAGTCACAAAGGATTGACTTTCAGAAATGGTTTCATAAGGCAGGGGCTTTGGGG
TGAGATTGGGAATTAGTATTTGTTTATGGTGTTGAGACAATTTAAAATGTTTATTTTGTG
CCCTTTACCCTCTTCCCAGGGGTTAGATGTAGATTCTCTGGTCATTGAGCACATTCAGGT
GAACAAGGCACCAAAGATGCGCCGTCGTACTTACAGAGCTCATGGACGGATTAACCCATA
CATGAGTTCCCCCTGCCACATCGAGATGATCCTCACTGAAAAGGAGCAAATTGTTCCTAA
ACCGGAAGAGGAAGTTGCACAGAAGAAAAAGGTAAATTATCTTGCAACTGCTCAGCTTTC
TTTGTGTGTGAAGAATGATTTGTGGTTGCTGTGATGACTATCTTAGGACACCTTTGGAAT
AACCATGAAAGCACATTATTCTGAGCAACCCTTTTCTTTATTTTGGCTTTTTAACAGTCC
AATTTGTTCCTCAACTAATGTAGTAATCTTACATTCAGTATATCAGGCAGTCCCATATGA
TTATCTGCTGGTGGCCACACCTATACTTAAAGCTGGGCACTTGGGAATTGTTTTGTAATT
GTCCCCTTAAAGCCTAATGTATTCAACTTACATTGGTTTTATTGTTTAAATATCCCATCC
TTGCTTCCGCTGAGGCCTTACGGACTAGGCCTTCTGCCTCCAGTGTTCATTATAAAGTCC
TCCAAGATAAAGTGGGTTTCTCCAAGAAACTTAACCATCCTTTTATTTTTTCTTTCCGCA
GATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAATAAAGTCAGCATAA
AATAAATGTAGATAAAAAAGGATATTGGTTGTCTTTATATCAGTATTTCCAGTGTCTTTA
CAGGGTGGATACAATTAGTTTACTCTGCACCAATGATTTTGACTCAAACATGCTGTTTTG
AATTATTGCTCCTTTGCATAAGATAGAGTTTAGAATGTGAGAAAATTCCTGAAACTGTTA
GTTTTTCAACAGAGCTATTGAGATTTAGCACACCGTACAACTTACCCATTTACACTTTAC
TAATTTATTCTTAGTAAGCTGTTATGCACACATCACATTGCCATCAATTTCGAACATTTT
TTATTTTATCAAAAAGAAACAAGGTGGTGGTTGTCATTAACTCTACCCCTAGGTACCACT
ATTTTGTCTTGTTTCAGTCTGTTCTTGACATTTTGTTGCAAATGAAGTCAGTAATTAACT
CTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1018..1040, 1239..1239, 1802..1936, 2250..2348, 3559..3654, 3657..3683
1001..1015, 1018..1040, 1239..1239, 1802..1936, 2250..2348, 3559..3654, 3657..3683
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved