Tupaia_belangeri Locus ENSTBEG00000011602
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000011602
Tupaia_belangeri
ENSTBEG00000011602
GeneScaffold_1291
SNORD14, SNORD14
3050..3137, 3455..3540
5186
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCTTTGC
TCGCGGTCTGGCGTTGGTACGCCCCGGCGGCGACTCCCGAAGCCGACTTTGGCTTTGCAC
CCAAGGCAGGGTCTGGTGTTTGCCCCAGTGGAAACGACCCGCGTCGGCGCCGGGCCCCAC
GGTTCTGGGGAAGGGCCCCGGGGCTCGGGTCCGGGTAGAGGCAACGTGCTCACCTCCGTC
GCGGGTCCCCAGGGCAATGCGTCCCTACCGCTGGGGTCGGTCTTTGCGGCGCTGGTTGGC
ACGGCGACTTCACTGAAGCGCTGCTCTTGGCCCTGCCTGGCTGCTTCAGACGGAAGGCAG
GCTTATGTCGCGGGTGTGCGCTTCCTGGTTATAAAGGGAAGCTGGAAACTTAAGCGTTCG
GCTTTCCCAGTCACGGGCTCGATATTTTCTTCGTAGCAACCATGTCTAAGGGACCTGCAG
TTGGCATTGATCTTGGCACCACCTACTCCTGCGTGGGTGTCTTCCAGCACGGAAAAGTAG
AGATAATTGCCAATGATCAGGGAAACAGAACCACTCCAAGCTATGTCGCCTTTACTGACA
CCGAACGACTGATCGGTGATGCTGCAAAAAATCAGGTTGCAATGAACCCCACCAACACAG
TTTTTGGTGAGTCATTAATTTTAAAGAATTATCACATGAACTTAAGGGTAATGGGAAACA
AGAATGCCAAGGAACTGTTAAATTTGTCAAATGTGGAACTAAAAGTCCTAAACGATAGAG
AAATCCCCGCTACTGGGACTCCTTTATTTTCAGATACGTAGTTCTGAAGGTTAAGGCATT
GGTTTTGTCAAGCTACACAAAGTGTAGATAAAGTGGGCTGTATAAACAGTTTGTCTACTT
AATGTATTAGTGTTATTTTAAATTTGACCAGAGAAGCAAAGAGAAAAAGCAAGCCACCAG
GTCCGGGACCTGAATTGTGGACCATGTGGGAGTCCAATGCCTTAATATCACGCCACCTGC
TGGCCTCAGGGTTGTATTGTGTATTCAGTCAGTCAGGCTCTTGGGCTTTACTGGGGAGAA
TGTTACAAGATTCTAAGGCATTTGTAATTGACTACATTGATACTGTTCACAGATGCCAAG
CGTCTGATTGGACGCAGGTTTGATGATGCTGTTGTCCAGTCTGACATGAAGCACTGGCCC
TTCATGGTGGTGAATGATGCAGGCAGGCCCAAGGTGCAGGTGGAATACAAAGGAGAGACC
AAAAGTTTCTACCCAGAGGAGGTGTCATCTATGGTTCTAACAAAGATGAAGGAAATTGCA
GAAGCTTACCTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGAATGTACT
CATCTTCGACTTGGGAGGTGGCACTTTTGATGTGTCCATTCTCACTATTGAGGATGGGAT
TTTTGAGGTCAAATCTACAGCTGGAGATACACACTTGGGCGGAGAAGACTTCGACAATCG
CATGGTCAACCATTTCATCGCCGAGTTTAAGCGCAAGCATAAGAAGGACATCAGTGAGAA
CAAGAGAGCTGTCCGCCGCCTTCGCACTGCTTGTGAACGGGCTAAGCGCACCCTCTCCTC
CAGCACCCAGGCCAGTATTGAGATCGACTCCCTCTATGAAGGAATCGACTTCTATACCTC
CATTACCCGTGCCCGATTTGAAGAGTTGAATGCAGACCTGTTCCGTGGGACCCTGGACCC
TGTAGAGAAGGCCCTTCGGGATGCCAAACTAGACAAGTCACAGATCCATGACATTGTCCT
GGTGGGTGGCTCTACTCGTATCCCCAAGATTCAGAAGCTGCTACAAGACTTCTTCAACGG
GAAAGAACTGAATAAGAGCATCAACCCTGATGAGGCTGTTGCTTATGGTGCAGGTAAGGC
TCTTAACTTAGCTTTAATCCTGTAAGCAGCCTGTGAGAGGTCCAGCTGACTCGCTATGAT
GAATGATTGATCAAACATTCGTAGTTTCCACCAGAAGCTTAGCTGCTGATGGCCTGACTT
CCTTGGATGTCTGAGCGAGTGAGGCCTCTCAGTGAGGCACGCTGAGTTCTGTTGAGAGAT
TAACATTCTCTTTCTGTCTAGCTGTCCAGGCAGCCATCTTATCTGGAGACAAGTCTGAGA
ACGTTCAGGACCTGCTGCTCTTGGATGTCACACCTCTGTCTCTCGGCATCGAAACTGCTG
GCGGGGTCATGACCGTCCTCATCAAGCGGAACACCACCATTCCCACCAAGCAGACGCAGA
CCTTCACCACCTACTCCGACAACCAGCCCGGGGTGCTCATCCAGGTATGGCGGCTCACCA
CCTTCTGCTTACTGGGGTCAGACCAGAAGTTTGTCTCGCTATGATGACGGATTCCAAAAC
CATTCGTAGTTTCCACCAGAAGTCTTGGTGTTGGCAGTTCCTTCCTTGGATGTCTGAGCG
ATGTCTCCTGGTTGATGACTTACTGTAATTTGGAGCTACAACTACGAGTAGCCCAAAAAG
CCATTGTAACTCCCCTTACTCTTCCAGGTTTATGAAGGTGAGCGTGCCATGACCAAGGAT
AACAACCTGCTGGGCAAGTTTGAGCTCACAGGCATACCTCCCGCACCCCGTGGTGTTCCT
CAGATTGAAGTCACTTTCGATATCGATGCCAATGGCATCCTGAATGTCTCTGCTGTTGAT
AAGAGCACTGGGAAAGAGAACAAGATCACCATCACCAATGATAAGGGTAAGTGCTCTGAC
TAGAGTTGTAATCTTCCAGGACACTCAGTCAGATGTTCAGTTACTGGTAGAGGTGTGGGA
TTGTAAATTACGGATTACAGAGACTCAAGCTTTGGCCTGTCTTTTCCTTCACAGGTCGTC
TGAGTAAGGAGGACATCGAGCGCATGGTCCAGGAGGCTGAGAAGTACAAGGCTGAGGATG
AGAAGCAGAGGGACAAGGTGTCCTCCAAGAACTCCCTGGAGTCCTACGCTTTCAACATGA
AAGCCACGGTGGAGGACGAGAAACTCCAAGGAAAGATCAACGATGAGGACAAGCAGAAGA
TTCTTGACAAGTGCAATGAAATCATCAACTGGCTCGACAAGAACCAGGTGAGTGCTTGTC
TGTGGGGGTGGGAGGAGTGCAGGACTCAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 1672..1871, 1974..1979, 2080..2232, 2333..2347, 2452..2992, 3201..3403, 3627..3825, 3954..4186
1001..1205, 1672..1871, 1974..1979, 2080..2232, 2333..2347, 2452..2992, 3201..3403, 3627..3825, 3954..4186
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved