Tupaia_belangeri Locus ENSTBEG00000006304
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000006304
Tupaia_belangeri
ENSTBEG00000006304
GeneScaffold_4258
SNORA65
3521..3646
5338
TGGCTCAGGCCCCTCTTGTCACCCCACCTGCCTGCAAGGCCAGGGCAGACAGTCCTCCC
CCACTCCTCCCTGATGAGCAGCTCTTACCCTACTGCTTCCTAGCGACTAGACTAGCCATG
AGTCACCCCCTTCAGGGGGTCCAGCCTTCCCCACCTCCTCTCAATGACCATCATTCTCTC
ACCCCTCTGCCAGGATGAGCTCTTTCCAATCTGCTCTTCAGTGTCTATCTCTCATCCATT
CCCTCGGCTACGCCCAGGTCAGGTGGGGAGGGCCAACCACACCCATCCCTCCCTAGTTGA
GGGGGGCTGGGGCGGACCTGGCTTTGTGGGTGGAGAGGTCGGGGGCTGCACCCCCAGATG
GCCCCGAAGACAGGCGGATCACTCGGAGGGCTGGGTCATGGACGCGGGTTCGCAGACCGC
CGGGCACGTTCGGGAGGAGCCGCAGTCTGGTCTCCTCCGAGCGCAGGAGCTGGGGACCGA
AACTCAGAACCTCAGAAAGTCATGCAGATCAGGATGACGAAGTCTGAGAGTCTGGGAACC
GCGCAGAATTAAGAGCGCGACTGGATTCAGACCTGCATAGATTGTTTCGGTAATTAAACC
GCACACACCACTAAGGGGTTAGAAGGGGACCTAGGTCGCCGACGTACTGGGATCCCAGAA
TTGGGGTGCGGACCCTTGAGGGGAGGGGCGGGGCTCTGGGTTTGGTGACAGGGACCCTCT
GTCGGGGGAGACCCTGACGATAAGGCAGTCTGAGAAAAAGAAAAGATCTCGGGAGCAGCC
CCTTCTTCTCTGCCTCCCGCCAGGCCAATTGCCCCGAAACCCTCTCCCGAATCCATAGCC
ACAGCTCACCTCGGTGCCCGGCTCTCTAGCTGTCCGCCTCAGGAGTCTGCCCATAACAAA
CATGGCGGCAAGGGCGACGCCGGGAGGTGGGGGCGGGGCCTGCAGTTATCGCGAGAGCCG
CGCTTTCCTGCCTATATCCGGCGTGGTCGGTGCGATTTTAGGCCTTTCGGCTTCCGGATC
GGGGTTCATCCGACACAGCCGACTCATCATGCCGACGAAGTTCGACCCCACGAGATCAAA
GTCGGTGCGTGCTCTTGCTGTGGCTGAGGCTGCGGGATCGAGCCCTGCTCCTCCCCGCGC
CCGCCGGGCCCGTTGCCTTGCCGGTGACAGGCTTTAGAGCTGCCGCCTGCTAGAGGCCGT
TGCGCTGCTGTGCCTTCGTGGCCGAGGCTTAGCCTTTCTGGGCCTCAGCTTCCTCACGTG
TAGTGGAGAGGGAGGACCGGACGACCTGCGGTGGCCTTGCAGCCCGCACGCCTTAGGGTA
AGGCCCGTCTCGGCGTTTTGCTCCCCTCGCCTGCTGAGCCGGCGGCTGGGCTGCCTCCGC
GCTTGCCCGCCGCGGGATCGGAGCCTCGGCGCCCCAGGGAGGAGCGGGTGGCGGGCCGCG
TTGCCCGCCGATCCTCGTACTCCCAGGCAGTTTAGAAAGCTAATGGGGAAACATGAAAAC
CTGACTTTATTTTGGTGCGAAATGTTTTGAAACTCGTGCAGTTTTTTCCATAATAGGCAT
TTTCCGCGAACTTTTTAAGGACACGTGTTTGGAGACGAGGCAGAGGGTAGTTTAACCAGA
AGGGGAGAGGGTGGGGGACTCGAGGCTTCCTCTGCAGAGGCACTGAACCTTCCTTTCTCT
CAGTGTACCTGAGGTGCACCGGTGGCGAAGTCGGTGCCACGTCTGCCCTGGCCCCTAAGA
TCGGCCCCCTGGGTCTGGTGAGTCTCCTTGCCCCTGGGCGGTTCTTTACTAACGTGAGTT
AAGTTCGGGCTTAAGTAAACGGACCTGTGCCAAAGATACGGTACTTTTGTCACCCCCTGC
GCCGCCGATCTAGCCAAGGGCTTAGGAAGGTCACAGGTGGGAAATCTGGCACCTTGAAGC
TGGGACGTGTCCCCCACGGGTCTTGGGGCTCCTGGAAGAAGGGCCCAGGAGTGATGGGGT
GCAGCATTGTTGGGAGGATTAACGGGCTGATGGGTGCGGAGCGGTAGCTTGAGTTTCCAA
CTCTAAGGGTAGATGTAAGCCTGAGTGGCCCATAGGGCCAGCTGTCATCCGAGGTCCCCA
GCAGCGACTGCGGGCTCCGGTGTTTCCCACCCATTACCCAAGGGCCTCTGTCCCACACAG
AGTTTTTAAACCAGCAAATGCTGAGGCCGCCATCCCCACAGATGGAGCTGTGATTGGTCC
CATGTGGGAACCTCGTACCTGAAGGGCTGCCAGATGATTGTCACCATGGTTGAAGCCCCT
ATATACATAGCAGTTAAGCCCTGAGAGGGTCTGAAAGGATTGGATAGGCCCATTGTGGCC
ACAGCTTAGAACCGGGACAAGACTTAACCTCCAGCCTCATCTTCCCAATTAGTGCTGTGT
CGGTAGTCAGGGAGGTGCCCCAGACAGCTTCCTGTGTCCTCGGTGTTGCCAAGTGAGAAA
TCCTAGGCAGGTTTTAAGGCTGTGGTTCAACTTTGGTCACAAAGTAATGACATTCTTCTA
TTTCTGCAGTCTCCAAAAAAGGTTGGTGATGACATCGCCAAGGCAACCGGTGACTGGAAG
GGCCTAAGGATTACTGTGAAGCTGACCATTCAGAATAGACAGGCCCAGGTAATAAAGAGT
GTTTGGTCTGGGGGCCAGCAAGAGGCATGGTGGGTAAGGCACAGGACTCTCACGTGGCTG
ACTGTAGATTGAGTCCTGGACCTGATGGCTTGCTTTCTCACTTTCTCTCACTGTCTCTCT
AGTCAAATTAAAAAATACAATAATAGCAACAAATCTTTAATAATGAATGCTTAGTTTAAG
GGAGGGCAAGAGTAGCAACCTTCTGGGGTTCCTTCCGGGGCAGGTTTTCCCCACCAGTAG
GGAACTAAGAGCAGTTTTAGCTTTGTGAGGTAAAACGAGGGAGCGTGGACACCTAGGACG
AAGACGTGGGTTCAGATATGTGTGGCATTAGGCAAATGATGACTTATGTCCCTCCCCTGT
CCCAACTAAACGTATTTTCAGATTAAAATTGCTTGAATGTGGCCCATGGTTTCTGACGTG
GATATGCATGGCATTGTTTGCTGGAGGTGGGGGTAGGGCTTAATCTGAGTCTCTTCTGCA
GATTGAAGTGGTGCCTTCTGCCTCTGCGCTCATCATCAAAGCCCTCAAGGAACCGCCAAG
AGACAGGAAGAAGCAGAAGAATAGTGAGTTGCCTTTTCTTGTGGTTCATGGTTGGATAAT
GTGCCTGGCGTTTGGTACAGGGCTGCATGTTTTCCCTCTAATGAAGCCTGCTGGTGATGT
GAGGGTTGTGGGGTGATTTGGTGAAGGCTATTAGAGCCAGGTACTGCCAGAAAGTGCTGT
ATGTTTCTGTAGCCTGTGTGGGGCAGGTCCCACCAAGGCTTCAGTGGGCTGTAAGCAGGA
CTGCACTCAGTGCTGGCTAAAGACTGGGTAGCTTGACTCCAAGAATTGCTTCTTGGCTCT
CCACTGTCAGACTAGGGAAGGTGGGGTTTCGCCCTCAGCCACCCGCCACTGCACCTGCCA
GCTGTGTTGGCTGGTGCAATCCAGTGGTGCGCTGATAGTAACCCCAGCTTAGGAAACAGG
GTTGTTCTTCATGTGGATGACTCTGTGCCGAAAGCGTGGGAACAGCCTGGAACCAGGGAG
GGAGGGCTTCATGCCATCTGCCCCGGCCTCAGGTTGTGGCAGATTTTGATTTTTTTTTTT
CCTTTTCTGCAGTTAAACATAGTGGAAACATCACTTTTGACGAGATTGTCAGCATTGCCC
GACAGATGAGGCACCGGTCTTTGGCCAGAGAACTCTCTGGTAGGATTACAACAGTGTGAC
CACTGTAACTATAATTGAGGTGGTTTTGCTGAATGGCTGGCTCTTTCCACTTTGAAGGAG
ACTTCACGAGACTGAGGACTGGGGTGCAGCCTGCATGGATGGGTTTGAAAGAATGGCTTG
AGATCTCGATCTGGGAGGTGTGGAGGGTTTGCCTAACTGGAGCCCTGTATGTCCTGGATT
AAAGCAGGGATACCATTCCTTCTCTTGCCTGCTGAGAAACTAGGCGGTATACCCCTGTCT
CAGTTTTGAGACTTGAGCCCTAATGCCACTTTTTCTTTATAGGAACCATCAAAGAGATCC
TGGGGACAGCCCAGTCTGTAGGCTGCAATGTGGATGGCCGCCACCCTCATGACATCATCG
ATGACATCAACAGTGGTGCAGTGGAATGCCCAGCTGTAAGTGACTTCTTAGTTTTATGTG
TGATAGGGAAAAAGCTGGAGGGGCGGCAGCAAGTGTGTTCAGAGATGAGCTCTGAAGCTG
CAGAAATGGCAATGGTGGGATTCTTTAAAAATTCCCTTTTACTGACGGCTATTTTTTCCT
TTGCAGAGTTAAGAAGTACACAAGAAAACAACTCAATAAAGGATCATGTGACAACCAGAG
TTTTTTGGTGTGGCCTCTTCTTAAGGGACTTGATTCCTGTATTGGGGTAGTCAGTGGGCC
AGGTGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1023..1034, 1037..1042, 1045..1068, 1071..1083, 1683..1756, 2529..2627, 3121..3202, 3732..3818, 4122..4272, 4278..4296, 4301..4327, 4330..4338
1001..1021, 1023..1034, 1037..1042, 1045..1068, 1071..1083, 1683..1756, 2529..2627, 3121..3202, 3732..3818, 4122..4272, 4278..4296, 4301..4327, 4330..4338
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved