Tupaia_belangeri Locus ATP5B
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ATP5B
Tupaia_belangeri
ATP5B
GeneScaffold_3011
SNORD59
1856..1930
10112
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGGACAAGGAA
AATACAACCTCAGGGTTCAACACCCAGTAACTCCGCACTTCCCTAAACGCAGTTCCGTCA
AGTACGCTTTCCAATGACATTCCTATAGTCCAATCAGGTTTCGAGGATCAGAGGGTTGCA
CCTCACTCACAGTGTCCAATTAAAAAGGAGATTTTATATTAGCACCAATTTTGACCAATG
GATGCAAAGATGAAAGTTTATTAGCCTATAGAAGCAGCGATGAGAATGATGAGCAGTAAA
TATACCCAATGGAATCGCCTATAGCAGAGTAGGGCTTGCCTCAACTGCGGGAGGTGGTGG
CCGAGACAGCTGCGGCGCTCAGTCTCCACCCGGACTCCGCCATGTTGAGTCTTGTGGGTC
GTGTGGCTGCTGCCTCGGCCTCCGGGGCCTTGCGGGGACTCAGCCCTTCATCGTCGCTAC
CCCAAGCTCAGCTCTTACTACGGGCCACCCCGGCAGTGGTCCAGTCCGGTAAGTGATTTC
TTCTAGTAACCGGGCCCATTTCTGTCGCCGCGTGACCTTGAACCGGAGGCCGATTGCAAC
TCGGGCCTAAGGGATTCGTGCTAGAAGGATGTGTCCTGCCCTCTAACGGCAAACGAACAA
GAATGTGTCGTTCGTGAAAGCATTTTACAACCCAGTTCTGTTCCATTTTGGTAAAAGGGC
TCTGTGATGAAAAAGTGCAGGCAGATGCGTTGACCTTCCCTTGGAATGAGGGTACCGGGC
TCTTGAATAAGAGGGTTCTGTGCATCAGGATGGGAAGGCTGTGCAGGCGCTTTTTCCATT
TCTGCGCGGCACCTCCTGTAGACCCGCCTTCTGAGCAAGAGGAAGGAGGCCGATCCCGGG
CTGAATTCGCTTTTCCTGGTGGCTTAGGCCGGGGCTTCCAATGACCTTTGATCATCCTTA
CGCAGATCCTTCTAATGTCTTTTTTCTGGTAGGCAGAGACTATGCCGCGCAAACATCACC
GTCGCCGAAGGCGGGCGCTGCCACTGGGCGCATTGTGGCCGTCATCGGTGCAGTGGTAGA
CGTTCAGTTTGATGAGGGACTACCACCCATCCTAAATGCCCTGGAAGTGCAAGGCAGGGA
AACCAGGCTCGTTTTGGAGGTGGCCCAGCATTTAGGTAAGTAGAATTTGTGTAGGAATAG
CGAAGACCTTGTTAAGCTCAAATATCTATTAAAAAAACAAACAAACAAGCTTTCTCCCTT
CCATGATGATCTTATCAAAATGACTTTCGTTCTTCTGAGTTTGCTGAAGCCATATTTATG
TACTGAGAAGGAGTTTTGGTTGGTTTTCAAGCCCATTACACTTTTTAAAATAGCATAGTA
TCAACTACTCCATGTATATAACCCATGATGCCTATTACCTGACAGGTGAGAGCACAGTAA
GGACTATTGCTATGGATGGTACAGAAGGCTTGGTTAGAGGCCAAAAAGTTCTGGATTCCG
GTGCACCAATCAAAATTCCTGTTGGTCCTGAGACCTTGGGTAGAATTATGAATGTCATTG
GAGAACCTATTGATGAGAGAGGTCCCATCAAAACCAAACAGTAAGTGCCTCTTCCTACAT
CTGTGTACAAAAGAGCTTTTTCTTGCAGTAGTACACATTAAGGTGACACCACCTGTAATA
GTAAAGGGTTTAAGTTTCCTGTAGAGAATACTTAAAATGCTAATATATTCAATTATTAAA
ATTGCACCATACAGTTTTTTCTGCAGAAAGTATGGATGCAGAAGTTCTGATGGACAAAAC
CCTGTTACTTATAATCCCTGTTGATTATTAAAGGCTTAAGTTTATGACATAGATTGAGGA
GTCTTCAAAATGTTCAGGTTTTTGTTTCTTTTTTCTTTTTTTTTTCTGAGAGGTTTTTGC
TATAGGGCGGTGTGTGCATGTGCCAGAAAGAGACAGAGAGACAAAACGAGAAATCACCCC
CCACGGGGAATGGCCACACTGCAGTCCCTTCTCCATTCTCCTCTCGGATCTTGGGCAGCA
TGCACCCAGCGTGAGTTTAAGGCACCAGGTCCAGGACTCAAACCACGATCGACTACATGG
GAGTCCAGCAACATAGCCATTATGCCAATTGCTCGTCCCAGTGTGCAGGTCTTTGAATTT
TCCTATTGGTATGTGAAGGAATGCTGTTAGGTTAGGGACTAGTAAAAGGGAAAACTCTAG
GATATAAATTATCAGGGAATGGGATTATTGGTTCCTGACATAACAGAGTCTCTTTTATTG
CAGAAAGTTGAGTTAGATGCTATATGACAATTTATCTAATATGTCACAAAAGAGGGAGCT
GAGTAGATCCTCAAAGAATTGGACTTGAGGGGGCCAGAGGTGTGTGTAATTAAGGGTGCT
GGACTCTACATGCAAACGTGTTCAAGTCCCGGATCTGGTGGCTAGCTTCTCACTTCTGAT
CTGCTCATCCCTCTCTGTCGATAAATAATAAGTATCTAAAAAAAAAAAAAAGTATGACTA
TGGACATTAAACCAACCTTTTTTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCCATGGTGGTTACTCTGTGTTT
GCTGGTGTTGGTGAGAGAACCCGAGAGGGCAATGACTTATACCATGAAATGATTGAGTCT
GGTGTTATCAACTTAAAAGATGCTACCTCCAAGGTAAGCACATAGTAATAGTGCTGGCAG
ACTATTGGCAGGTGAAGTCAGGTTTTATATTTTCATTTTGTTGTCTCAGGACCTACAAGG
AAATTCTTGCTAGTGTTTCCCATTTTAAAAAAAATACTTAATTTTATTTATATATTTTTT
AAAGAAATATTTTACGTGGCTTTCTTTCTTTTTTTTTTTTTCTTGAATGGTTTTTGTTAT
AGGGTGCGTGCGCTTGCCAGAAAGACAGATAGCAAGTGAGAAATCATCTCCTGGGGGAAT
GGCCATGCTGCAATCCCTTCTCCATTCTCCTCTCAGGATCTTGGACACATGCACATGCCC
TTGGCTTGAGCTTAAGTCACTGAGTTGAGACTTGAACCGCAGTTGACTACATGGGAGTCC
AGCGACATAGGCATTACGCCAGCTGCTGGTCCCATTTGGCTTCCTTTTCTTTTCTCGTCT
TTTCTTTCACCACCTGCCGGCCCCCTTATTTATTGATTTTTATTTGACCAGAGAGGGACA
GAATGAGAAAGAGAGAAGGAAAGAGAGAGCAAGATGCCAGGTTTGGGACTTGAACTGTGC
TTTGTCATGTGGGAGTCCAGCGCCCTTAATCACCATGCCACCTGCCAACCCCTTCTCTCC
CATTTTTAATATACTAATGCATAGTTTCATTTCTTTTTGGCATTATTTCATATTTTTAGA
CTTTTCTTTTTAGTAGATAGTGCCATCATTTAAAAATAAATTTAGGGGGGAAGATGGAGA
TGGTTTATATGTCTCAGAGAACCCTAGTTTGTACCTTTCACATACACAGGTAATTATTTA
TTTTGTACTGTAAGAATTTTGCCTTAGTAATACATGTATAAAATTTCACAGGGCCAGCAG
GTGGCGTGGTGGTTAAGGGTGCTGGACTCCCACATGGTCAACAGCTGTTTGAGTCCCGAA
TCTGGCAGCTTGCTTTCTCACTTTCTTTCTCTCTTCTCCTCTCTGGGCAAAATAAATAAA
TACATTTCTCACTTTCTCTGTCTCTCTGTCCCTTTCTGGGCAAATTAAAATGAATGAATG
AATGAATGAATAAAATAAAATAAAATAATTATTTTAAAAAATTTGTGTTTTGAGCTGCTC
TCATAGGGAAAAGAAGTTTGCAAGCAAAAACATTGATACTTTCTTAAAAGGAGGTTCTGT
ATTTTCTCTCTGATTTGGGGATCTTGGGTTTGTGTTTTCCATATGCCTGCCAGGTTTTCT
GACTCTCTTAATTACTGCAGGTAGCACTGGTTTACGGTCAAATGAATGAACCACCTGGTG
CTCGTGCCCGGGTAGCTTTGACTGGACTGACTGTGGCTGAATACTTCAGAGACCAAGAAG
GTCAAGATGTGCTGCTGTTTATTGATAACATCTTCCGCTTCACCCAGGCTGGCTCAGAGG
TAAGCTGGAGGGTTTGAAAAGACCTGGTTCATTTGACCTTTCTGTGGAGTTCTACAGATG
AGGCTAAAGATGTAGACATCTAAGACCTATGTTGTGACTCTCTTGTCTTAGGTGTCTGCT
TTATTGGGCAGAATCCCTTCTGCTGTGGGCTATCAGCCTACCCTGGCCACTGACATGGGT
ACTATGCAGGAAAGAATCACCACCACCAAGAAGGGTTCTATCACCTCTGTACAGGTAAGA
AAAATGAAATCGACAAAGGTCTAATCTGCACAAATACATGTAGCAAGAGCTATGAAAGCT
AGTTATTTCTTGTAAATGCCCTTTGAGGGCCAGCAGGTGGCTTGGTGATTAAGGGCGCTG
GACTCTCGCACATGGCTGACTGCAGTTCAAGTCCTGGACCTGGTAGCTTGCTTTCTCACT
TTCCCTCTCTCACTTTCTCTCAATCTAACCCTCTCTGGCCAAAGTAAAATAAATTAAAAA
AAAAAAAGTCCTTTGATGTTCATGAGTTCTTTGGATAATATGTAAGATTCTGTGTATATT
AGGTGAAGAAACACTCATCTAAAGTGATTGAAATACACTTGTAAATGTACATTACAAAAT
AGCAGTTTCCAGCCTAAAGGGAGGCCAGAGCTTCATGGAAACTAGTTATTAAATATTTAC
AGCATTAATGTACCATAGATTTTCAAGTATATAAAGAATATGTCTAAATTGTAGTCACTT
TTGTGATTCATTTTAATGAGCTATTGTACAAAAAGGCTTTGTTCTTATTTGTAACTCTTT
TTTTTTGGAGAGGTTTTTGCTATAGGGTGCGTGCGCTCGCCAGACAGACAGAGAGACATA
GAGACAGAAAGCGAGAGATCACCCCACAGGGGGGATGGTCACGCCGCAGTCCCTTCTCTT
CCATTCTCCTCTCGGGATCTTGGGCACACACGTACACGCGCCAGGAGTGAGTTTTAAGCC
ACGGGATGCGAACCGCGGTCGACTATGTGGGAGTCCAGTGACATAGCCATTACACTAACT
GCTGGTTCCCGAGTTCTTATTTGTAACTCTTTTTTTTTTTTTTTTTTTGAAAGGTTTTCT
CTATAGGGCGCGTGCGCTCGCCAGACAGGCAGAGACATAGAGATAGAAAGCGAGAAATCA
CCCCCCAGGGGGATGGTCACGCCGCAATCCCTTCTCCTCCATTCTCCTCTCGGGATCTTG
GGGAATGCACGCACACGCGCCCGCGTGAGATTTAAAGCCACCCGGTCCGAGACGCGAACC
GCGGCCGACCTACGGGGAGTCCAGCGGACATAGCCATACGCTACCTGCTGGTTCCCCTTA
TTTCTAACTCTTAAAAATGTCGTAAAATGTATAATAGAAAACATAACGAATGAATGAAAA
TTCTCTCACGCTTAAAAGGATGAGTTCATTTGATCTGAGCGTACTCAGCAGAAATAGGGG
GATTACCCTTTTGTGGCGCTCTTTAAAGGCTATATAAAGGAGATGAAATAGAGAAGCCAG
AAGGGGAAAGTTTAATCGAGGTAAATGGGGTCTGCGGCTCTTCCAGAATTCTTACTGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTATGGATGAACTTTCTGAGGAGGACAAG
TTAACTGTGTCCCGTGCACGGAAAATACAGCGTTTCTTATCTCAGCCGTTCCAAGTTGCT
GAGGTCTTCACAGGACATATGGGGAAGCTGGTACCTCTAAAGGAGACCATCAAAGGATTC
CAACAAATTTTGGCAGGTAAGATTTTGAGTACAAGCTGAATAAAAAATTAAAAAACTGAA
ATCTTGACTCTTGCCTGATGATATTCCCATTACAGCTGTCAAGCAAATATAATTTATAAG
TAGCTATTTTTCTACCAGTTTTGTTTGAAAATACATTTCACTTTCAAGAATGTAATTTGT
ATTACTTGATTCTCTTAACTCCCTTCAATCTATATAATCCAACACTTACTGTTTTCGGTG
GGAGCTACTTACTCTTAAGTGAATTTTTTTTAAAAGAGTTTTTTTGTTATAAGGCATGTG
CACTCACCTAAGAGAAAGAAAGTGAGAAATCATCCCTGGGGGGGCGGATTTCCACTCTGC
AGTCTGTTCTCATCCATTCTTCTCTTGAGATTTTGTGCACACACACGCCTGGCATGAGTT
TTAAGCTGCTGGATGTAGGACTTGATGTTAGTGGACTAAGTGGGAGTCCAGTGATGTAAC
CATTACACCACCTGCTGGTTACCTCTAAGTGAATTATAAATGAAGAAACTGGGGCACAGA
GAAGTTTAAAATAAACTGTCCTAACATATGATAGCCAAAGTAGAGAAGAAGAATTTGAAT
TTAGGGGCCAGCAGGTGGCTTGGTGATTAAAGCATTGGATCCCGTATGGCCAGCTCTGTG
GTTTGAGTCCCATACCCAGCTGCCTGAAGAACATACGAGGCACTTGTGCTTGTGTGCCCA
AAATCCAGAGAAGAGAATGAAGGAGAAAGGATTGTGGTGTGGCGATCTGGCCTGGAGGGG
TTGATTGATTTCTCACTTTCTCTCTGGTGAGTACTCACATCATATGGCAAAAATCTTTTA
AAAAATTTTTTTCGAACTCAGTTTCTGTGTCTTCTGACCATGTATTCTTAATCCACAGTT
ACATATTTTCTTACAAATTTGATTTGTTGAGGGAAGCTTAAGAAAAGTTTTTTCAATTAT
TTTCACTTTATTTATTTAATTTGACCAGGGAGTAAGTGAGAAAGCAAGCCACCAGGTTTG
ATACTCAGACTGTGGTTGGTCATGTGGGACCAGCACCCTTAACCACCATGCCACGTGCTG
GCCCCTGAGAAAAAGTTTTTTTAATGACATGGATTCATCATATTCTGACTGGTAGCCTCA
AGTCATGAGGTATGTGTACCCTATAAAACTTATGAGCCTTTCACTTACTAGTTGGATTTT
TTTCCCATATAGGTGAATATGACCATCTTCCAGAACAGGCCTTCTATATGGTGGGACCCA
TTGAAGAAGCTGTGGCCAAGGCTGATAAGCTGGCTGAAGAGCATTCGTCATGAGATGTCC
TTTTGGCATATTAAGCACTCATCTTTGCTGTTCCTCTCCTTCCCCCAATCCAAAAAGCCA
GTTTTTCGTGTAGGCCACACAAGAGCCTTGATTGAAGACATTGTTATGTCTGAAGAGTAT
TTAAGGTTTCCAATAAAATGTACATCCCTCAGAATTTGTCTTTTCTGGTTCTGACAACAT
AGCCAACACCAAAGTTTCTGATAATAAGGTTTTTAGAATGGCCAGCCATAAGTTTTTGCA
CAAATTAGACCATGCATGTTTGAAATGGATCATCAAAAAGAGTAATAGCTGTTCTCTTGA
CAAGTGTGTCTCTTATGAGGGGTCTTTGGGGAGAATGTGATCTTAGTGGGGCCTTAGCTT
TGACCCTTCTATGGCATTTGTTCAAGCACATATTTTTTTAGAAGGGCATATTGTAAATAT
GTGATTTAATTTTTAGAGCTAGCATTCCACGAAAGTCAAGAGTATGTGAATTGAGTTTTT
AGAAATAGTGATGACCAATACTTTAAAACTGAGTCAAAATTCCCTTACATTTTAGCTAGG
CTTTCATTTCTATGGAAAAAGTTCCTAAATCCTTATCAAAGCCTTGAGGCTGTGTGGGAG
TGTCTAGGAGGCCCAGCCTGATCTCTGCCCAAGATTCCTATTAAAGCTTGGTACAGAGAC
TTAGCCTGTTATTAAGAATAGCAATTTTAGGGGCTCTGAACTGAATAACAGGATTAGGTC
GTTTCCCATTCATTATATAGTCCACACAAAGGTGCAGGGTTGGAAGAAACACTGCCATTT
CAGTTTTTAAAAGTGCAAGCAAGGTCAGATTTGTCTCAAGTATTATTTTCCCTGCCCAGA
CCCATCCTACTGCCCTCTCCTGGTAGCACAGTAGACTGCGAGAACTCTGATCTCACCATT
TTGAAATCCGTGAAGGCCATTTGCTGGGATGTGGTTCTCAGCTAATGACTGTTTACAAAC
CAGCTGGGCTTTTGTCCTGAGGAGGAGCTTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1592..1774, 2025..2199, 3508..3629, 3988..4172, 5420..5578, 5691..5813, 7269..7481, 7614..7815, 9012..9112
1001..1127, 1592..1774, 2025..2199, 3508..3629, 3988..4172, 5420..5578, 5691..5813, 7269..7481, 7614..7815, 9012..9109
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved