Tupaia_belangeri Locus TCP1
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri TCP1
Tupaia_belangeri
TCP1
GeneScaffold_1781
SNORA29, SNORA20
1212..1350, 7655..7788
11190
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTATTGCAGCAGAACTTC
TAAAAAATGCAGATGAACTGGTCAAACAGAAAATCCATCCTACGTCAGTTATTAGTGGCT
ATCGACTCGCTTGCAAGTAAGATGGTTCTGCATTCAGAGATATTTTGTCTGTTCCCTTCA
TGTTTAAGGACTAAAGTTTAATTTGAGAAAGCTATGTTTTCTCTGTGTTTGAAGAACTAG
TCAGTGTGTTACCTTCCCGTTTGACTACCACATTTTCTCCTTGTAATAGATTTTAGTGGC
TATGCTTACGGGATAGATTAAAATCGCCATGATCTGAAGAGGGAGGGTTTTTGGTGTCCT
CCTCCTATATGAAATGGCTGAACAGAACATGGTTGTCTATGATACTTTGGCACTGTGCAA
AATGTGATAAATCCGAAATGTTCAAGTTGTAAGTTTACGTATTTTTCACCCCCACACGTT
ATACAGGGAAGCAGTACGTTATATCAGTGAAAACCTGATTATTAACACAGATGAACTTGG
AAGAGATTGCCTGATCAATGCTGCTAAGACATCGATGTCTTCTAAAATCATTGGAATGTA
TCCTTGCGATAGTCCAATAAAATATCAATTTATAAAAGTTAATATTGACTAGAGAACTGG
AAGTTCCTTTACCCTTGATACTCTTTTTCTAAAGAATTTATTTACTTATTTATTTATTTT
AATTTGACCAGAGAGGGACAGAGAGAGAGAAAGTGAGAAAGCAAGCCGCCAGGCCCGGGA
CTCAAACCGGGCCATGTGGGGGTCTAGCGCCCTTAACCACCACGCCACCTGCTAGCTCCT
AATTTTATTTATATTTTTATTTTTTTATTTGAGCAGAGAGGGACGGAGTGAGCTAGAGAG
AGAGAGAGAGAGAGAGAAAGTGAGAAAGTAAGCAGCCAGTAGGTCTGGGAGTTGAACCAC
TGTTGACTATGTGATAGTCTAGTGCTTTTAACCACCATGCCACCTGCCGGACCTAAATAC
CTTTGATTTTCAAAGTGTGCCTTGTTTTCATTCCAGATCTGTTATCCTTAACTGTTGGTT
TTAGAAATGGTGACTTCTTCGCCAATATGGTAGTAGATGCTGTGCTTGCTGTTAAATATA
CAGATATAAGAGGCCAGCCTCGCTATCCAGTCAATTCTGTTAATATTCTAAAAGCCCACG
GGAGAAGTCAGACGGAGAGTATGCTGATCAATGGCTATGCACTCAACTGTGTGGTGGGGT
CTCAGGGTAAGGTTCAGAATGAGATTACTACAAGGGAACGCTAACTTCTTGAAGGCTATA
CATAGCACATTGTTATGTAACTGAGGGATTTGAAGCTATTAAGATGAATGTTAATTAAAA
GAAACAATGTGCTTTAATGCCATTAAGTTTTTCAAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGACTATTGGAGAAGCACCCAAGCTAGTCA
GTCTCAGAACTGGCTTGGGCTTCTAGGGCTTCCTGCTTCTGTGTGTCCGTGTCCGTGTCC
GTGTCTGTGTCTGTGTCTGTGTCTGGATTATCAGTGCTGTGGGGGAGATGGTGATTTTTT
TTTTTTTTTAGAGAGGTTTTTGCTTTAGGGTGTATGTGCTCGCCAGAGAGACAGAAAGTG
AGAAACCACCCTTTGGGGGGATGGCCACACTGCAGTTCCTTATCCTCCTGGGATCTTGGG
CACACACGCGCCCAGCATGAGTTTAAGCCACCGGGTCCAGGACTTGAATGGCAGTCGACT
ACATGGGAGTTCAGCAACATAGCCATTACACTAACTGCTGGTCCCAAGACAGTGATTTCT
TTAGGACAGTATCTAGCACACTGTACTTGTTTCAGTAGCTGGGGTTTAAAGGATTTTTCT
TTTTTAAGTGGGTTTTTGCTCTAGGGCGGCGTGCGCTTGCCAGAAAGAGTGACAGACAGA
AAGCGAGAAATCATCCCCGGGGGTGGGTGGCACACCACAGTCTCTTCTCCATTCTCCTCT
CGGGATCTTGGGCACACACACCCAGTGTGAGTTTAAGCCGCCAGGTCCGGGACTTGAACC
ACGATTGACCATATGACAGTCCAGATACCCATTACGCCAACTGCTGGTCCCATAGGATGA
TTTTTATCTTACTTACAAAATTCTTTGAATAATCTCATGTATCCACATGCCTTCATCTAC
CATTTCCCCCCATAGTTTGCTCTTAATTTCTGTGCTATGTCTGACTGCCTTTTGGCAGCT
TTCCCTTCAACCTCCCTCAACCTGAACTCCGACTTCCCATCTGAGCCCAGCCTGTTGGCA
CTTATTTTACTCCAGGAGCCAGTGGCTGCCCCTCCCAGTTACCCATGCCATAAACTTACA
CTTCTCTGTTTAGGCCATCTGTTCTCAGCAGCCATACTCCTGTATTTCTAGCTCCTGTTG
CCTTGCTTTCAGTCATCCGTCTTTCCAGTGTACTTTCTACGATGATATCAGGAGATCTTC
TTGAAAGCACAGGATTGGTCATACTGATCTCTTAAACTACCAAGCTTTGGGGCAACCAGG
TTGTATGGTGGTTAGGGCAGCTGGATCCTTCGTGGCCAACTGTGCAATTGGGTTCCAGAC
CTGGCAGCTTGAAAAACACACCAGGCACATGTGCACATCTGTCCAAAATCTCAAGAGGGG
ATTGGAAAAGGGATTGCAGTGTGGCCAGGGATGCTTTCTCACTGCTTCCCTCCTCCTAAG
CTGCATTATGTGTTTGTGCCTGTAATCTCTGCATACGGCCTTAGTGATAGTTGCCTACGA
GAGAGATTGTTCAAACCTTTGCCATCTAGATCCTTGAGGACAGCCCTGGTTTTTCTTTCT
AACAGTTCTTGATTAGGAGCTCAAATTGGAATTGGGGAGTGTTGAGTGGTCATTTTTAAT
TTCTTTACATTTTCTATAAATGGAAACTAATTTAAATTCCTGGCCATAGGTGGGGAAAAA
ATTAATCTACACTTTTATGAAAAATACCCAATGGAAGTTAGAACTATATTACAGAGGGTG
ACTTTGGGTTACTTAAATATTTTTTCTGTAGAGAATCTGATATCACCAAGGAAAGAATTC
AGAAGATTCTGGCAACTGGTGCCAACGTTATTCTGACCACAGGTGGAATTGACGACATGT
GTCTGAAGTACTTTGTGGAAGCTGGCGCCATGGCGGTTAGGAGAGTTTTGAAAAGGGACC
TTAAGCGCATTGCTAAAGCATCAGGAGGTAGGTCTTCTGCCACATCTCCGCTGAAGTATG
TCATGTTAGCGTACACGGCCATGTCGGGGTCTTTCCACGTTGGAATATTGACACTAGGCA
GCGTCAGAAACATGTTTACTCCCTTATGCTTATGTTTTATTTGCTTAAGTATTACAATAC
AGGGACCAGCAGATGGGGTAATGGTTGTGTTGCTGGACTCCCCCGTAGTCCACCACGGTT
CAGGATCTTCGACCCAGTGGCTTAAAACTCACGCCAGGCATGTGTGCATGTGTGCTCAAA
ATCCCAAGAGAAGAATGGAGAAAGGATTGCAGAGTGGCCATCCCCCCCAGGGGTGATTTC
TTGCTTTGTCTCTGTTTGTTTCTCTGGTGAGCACATGCGCCCTATAGCAAAAATCTCTCT
TTAAAAATTTATACACACAAAATAACACTCATGCAATTGGAAAAGTTCCTTAACTGAGTT
TTGTTAACTTCAAAAATAACAAAGCCTCCTTTTTTCTTTTTTTGGGGGGAAGGGAGAGAT
TTTTGCTATAGGGTGCATGCGCTCGCCAGAAAGAGAGACAGAAAGTGAGAAATCACCCCC
AGGGGGGTTGGGCATGCACACATGCACACCCGGCATGAGTTTAAGCCACCAGATCTGGGA
CTCAGACCGTAATTGACTACATGGGAGTCCAGTGACATAGCCATTATGTCATCTGCTGGT
CCCCAAAGTCCCATTTTTTAAATATAGTTATTTAACTTTAATTTGAAGAGTGGGAGACAG
AGTTGGGGGAGGGAGGTGTGAGAAAGCAAGTTGCCAGGTCCAGGACTCAGACCACAGTCG
GCCGTGTGGGAGTCCAGCATCCTTAACCACTGTGCCACCTATTGACCCCAACTAAGCTCC
ATCTTTTGAATAAAAGGACAGTTGCCTATCCTCTGTTAGCCTGAAACTTGTATTCTTATA
CATCATATCCACAAGTGTTTCTGAATCTAAGGCAGGATATTTAAAGTCATGGTGGATGGA
TAGCCTTACAGATCTTTATAACTCTTGGCAGCAACTATCCTGTCAACCCTGGCCAATCTG
GAAGGTGAAGAGACCTTTGAGGCTGCGATGTTGGGACAAGCCGAGGAGGTGGTACAGGAG
CGGATCTGTGACGATGAACTGATCCTGATTAAAAAGTAAGAGCTATGTTTTAAATTGTAC
AGCTGCATGGATTTTGTTGAGTAAAAGCCTACTTCCTTCCCATTTATTTGCTGCTATTGT
CTTTCAGTGATATGAGCAGTTATACGCATGGGATAAAATAATGGTGCACCATTGTAAATT
GAGATGAGCTGATTACCCGTTTCATCTCTTCGTCATGGTCTACACATTGCTTTTGTACAA
TGTCTAAATACCCTTTTTAAGCAGGATTAAAACAAGGATGTTTGCAGTGAATACTGTTTT
TAAGAATTTTCCTTTTTGTTTTTAATAGCACTAAAGGCCCGTACATCTGCATCAATTATC
TTACGTGGGGCAAATGATTTCATGTGCGATGAGATGGAGCGTCTCTGCATGATGCTCTCT
GTGTGGTGAAGAGAGTTTTGGAGTCAAAATCTGTGGTTCCTGGTGGAGTGTGCTGTAGAA
GCAGCCCTGTCCATATACCTTGAAAACTATGCAACCAGCATGGTAAGAGGAGTTACTTAT
TTTTAAGAAGGGGATGGAGGACAGTCTGTAGCATTTTATTAATATACCTCTTCTGCAACC
TTTGGTATTTTTTTTTTTTTATGAAAAGACATCTTACTGTCTCTCTTCTTAGGGATCTCG
GGAACAGCTTGCTATTGCGGAGTTTGCAAGGTCTCTTCTTGTTATTCCCAATACACTGGC
AGTTAATGCTGCCCAGGACTCCACAGATCTGGTTGCAAAGTTAAGAGCTTTTCATAATGA
AGCTCAAGTTAACCCAGAACGTAAAAATCTAAAATGGTAAGCATGGAAGTTCCCTGTCTT
ATTGTTTCCGACTCTTGTCCGGTGATGTACACAGACTTGGTTCCAGGACGCCCGTGAATA
TTAACATGGGCATATGCTTAAATCCTATACATAAAATGGAGTATTTGCATATAACCTGTG
CATAGCCTTCTCTATACTTTTGTCTCTAGGCTATAATTACCTGATAGGATGCATTATTGA
AGTAGTTCCATTATGTTGTTCAGCGAATAATAGCAATAAACAAAGGTTAAAAGGATGGTT
AATACTCAGGGCAGATGCAGCCATTACAGTTCTAACTACAGGGCCAGCCAAGTAGTGTGG
TTAAGGTGGCTAGATCCCACACAGCCGACTACATGGTTCAAGTCCTGGACCCAGTGGCTC
AAAAGACATGCCGTGTGTGTACGTGTGTGTACACGTGCACACGCACACATACGTGGCCAA
AATCCAGAGAGGAGAATGGAGTAGGTGGGATTGTGTGTGAGGGAGTGCTTTTTCACTTTC
TCTTATCTCCAGCAAATGCCTATAGCAAACCTAAGGGGGAAAAAAGTGTTGGCTACATAG
CAACAACGTAACACTTCCACTGGAGGTTGTTGAAGCAGAGCGTGCAGTACTGTCCAACTA
AGTTCTGTTTCTTCTATGGCAAACTAGGAAGAAAAGACTTTGGCTACATCTACACTGAGT
ATTAACCATCTTCCCCCCCCTCAATGATTTTTGTTTATTATGAGGTGTGTGTACTAGCCA
GAGACGCAGAAAGTGAGAAATCAAACACTCCCATGCCCCCCAGAGGATGGCTATGCTGCA
GTCCCTTCTCAAGATTTTGGGAATATGCACACACACCCAGCATGAGTTTCAGCATCCAGG
TCCAGGATTTGAACCACAGTTGGCCATGTGAGAGTCCAGTGACATAGCCATTGTGTCATG
TGCTGGTCCCTAACCATCCTTTATCTTTTTTTATTGCTATTCCCTGAACAGTGTAGTGTA
ACTACTTAAAAATCACTAGGGTCATGTGCCTGCCTGCACAAAATCCAGGATGGAGGAGTA
GAGAAGAGACTGCCATGTGACCACACTCCCATTAGGTAGCGTTTCCGGTAGCGTTTCCTC
CCGCTCAGTCTTAACCGGTGTTTGTTGTTAAGTCATTCATACCTAGTTCAAAGGATAGTG
ATGAAACGATGATTATTAGCACTGGTGTGTTTTAGTTAACAACTAATTCCTCACTTTCTG
CTTCTATAGAGGCAGTGAGATGATCTTAAGGTAAATGATGGTTTTTTTACACCACCACCC
AGGCATTTTCTACAACTCTCAGTGCTGTTTGTTATTCGTAACTAATTTAAATTTTAGAGG
TCTTGCGTATAGGTCGGCTGGGCCTCCCCCAGAAAATGACAAAGAAATAGAAGCAAAAAG
AAATTCCCCCCCCTGGGGGGAGGCCCGGCCGCAGTACTTTTCTACTACATTTCCTTCTCA
GGATCTTGGGCGCACACGCATCTGTCGTGAGTTTAAGCCACCAGGGTCTGGAACTCGAAC
CGTGGGAGTTAAGCGACATAGCCATTATGCTAACTGCTGGTACCCTTTTTTTTTTTTTTT
TTTTTAAATTGTAGGATCGGTCTTGACTTAATCAACGGTAAGCCCCGAGACAACAAGCAA
GCAGGGGTGTTTGAGCCGACCATAGTTAAAGTTAAGAGTTTGAAATTTGCAACAGAAGCT
GCAATTACTATTCTTCGGATCGATGATCTTATTAAATTACACCCAGAAAGTAAAGATGAA
AAACATGGAGGTTATGAAGATGCTGTCCACTCTGGAGCCCTCGATGACTGATCTCTTTTT
TATTTATAACAATGTTAGATGCAATTGTCTTGCTCTCTGGTATTACACATTAAAGAACAG
CAAGCTGTCTGTGAAGTAGATGGTTTTCCATTCTCACTTTGATCCTCCCATTTCCCACTT
ACATCATTCACATTAGTTCACTTAGTTGAAGTATGCTTTAACCGTTACGCAGTTCATCCT
CTCTGAACACACATCGCTATTCCCATCCCACCCCCCACGCACAGCGCCGCAACACCGCGT
GTCCCGCCTGTCCTCTCCAGCGCGTGCAACAGGGTCACGAGAATCCGGCAGCCAGATGCT
CCAAGGGGGTGTCCCAAGGCTATAGCCCCTCCTTGAATGTTGACCTGAGAGGAAGAGAGG
TTTTCATTTACACATTTGTGAACATGGGTTAAACTTCTAAGTTTGTCTTTTTACCTCTTA
AACTATCCATTCAAACTCAATATTCATGTCAAGGATTTAGGAGTAAGTTGGTGCTTCAGT
GATACCTGTTCCTGACCACCTCCCATTTCATAGTACAAAAATGATTTTCAGAACATAAGA
TGCCTACTTGTATCTGGGCAAATTATTACAGTAGACCAGACTTGGTCCAGTGTACTTACT
GCACTGCAGTACAGGTTCAGAGCCCATGTGAACCTGAAGACATGCTAGGTGCATGCACGC
CCAAAATTCTGACAAGCTTGGGGAAGGTACTACAGCCTGATGAGACCCTGGCTTCCTGTG
ATGCTCTGCTCCACTTGGGCGTATGCATGATTATGAATAAAAATACTTGAAAAACCTACA
GTCACGGTTGTTGGCCTTGGAACACAACAAAACAAGTGAATTCCTCAGTCCCAGTGTGAA
CAAGTATCTGCCCATTACCAAACAGCCAATACCTGGAAATAATTACCATTTCGAAATTTA
AGACTATGCAGGGGGGAGGGCTGGCAGGTGGCGGGTGGTTAAGGCCACGACTCCCACATG
GCTGGCTGCCTTTCAAGTCCCTGATCTGGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1095, 1446..1556, 2044..2225, 3448..3574, 6271..6446, 7471..7594, 7888..7893, 7895..7958, 7961..8027, 8029..8081, 8212..8375, 9974..10190
1001..1095, 1446..1556, 2044..2225, 3448..3574, 6271..6446, 7471..7594, 7888..7893, 7895..7958, 7961..8027, 8029..8081, 8212..8375, 9974..10187
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved