Tupaia_belangeri Locus MAGED2
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri MAGED2
Tupaia_belangeri
MAGED2
GeneScaffold_369
SNORA11
7916..8047
10526
ACCACTTCCGGCTTGAAGGGGGTAGGGCAGTCTCCTAGTTTCGAAGGGGCTTGGAGAGA
TTGGACATCCTCGGGAGTTGTAGGAGGACGAGGTGAGCAGCAGGGACTAGCTTTGTATGA
CAGCCCGTTAGGGGTCGGCCCCACCCTCTGGGATCTGGAGAAAACCTGCCTTAAGGACTA
GATCATACCGGATCCATCTGGCTGGAAAGGAAGGGGACTGGACCGGGTTTGTCCGGGCCC
AAGATGGAATCTCTAGCTCAACACAGATCTGAGGAGGGGGTGTAATGGGGAAGGGGTGGA
ACCAAGACGAGCTTTGCCCTGGTTTAGAGGGAGGTGTGTTAGAAGAAAAGGCAGAACTAG
GAGGCACTGCAGACTTGGTGGGGTGGGTGCGAGGGAGGGTCCGGGACCACCAGACGCTGC
AACAACTTGAGAGGGACATTTATCGGGGTGGGGGCGGGACTGAATGGCACTGCAGACCTG
GAAAGGGATGTGTGTGAGGAAGACTGCTGGACTGAGACTGTGATCATTTCGCATGCGCAC
TATGTACCTCTGTAAAGGGGCGTGTTGAGAAGGGCCAGTATGAAGGGCCAGCTGCCGAAT
GCGCATGTGCACGGTGGACATCAAAGAAAGGGCTTGTGCTGAGAAAGGGGTTGGACTGAG
ACGGGCTCTGCAGCAGATGCGCATGCGCATTGTTGGCCTGCGGCTGTGGGGGGGCGGGTG
AGTGCTTTGAGAAAAGGGGCGGGGTCCTTAGAGCTGCTGAGCTGGCACATTTTCCTGGAG
AAGGGGAGAGTGCGGCTGCGGAGAACTGAGAGCTAAACGTTTTGGATTATTGTGTCTGAG
AACATTGTCTTTTGGGTTGTAGGAGGGGCTTAGGACTGGGGCCCTAGGGAAGGTAGGGAG
CAGCCGCCAGGCAGAACAGGGAAGAGAACGTTCTGTGGTCTCTCTGCTTGACCCAGGTTG
TCTCCCCTTCAGGCTCAGCTCTTGCCAGGCCAATTTGAGACATGTCTGACACAAGTGAAA
GTGATGCGAGTCTAACTCGCTTCCAGGTAAGGCCTCTTTCTGCCCTCTCTCTAGCTGCTT
TTCCTCTTCAGGTTTTGTCAGAGGCCTGCTGCCTGCTGCTGGGGACAGGATAGGCTGTGA
GAGGAGGAAGAGCAGGAAATTAACAAGAGAATAAAGAAGCTTAAAATTCAAAGCAGAAAG
TAATGGTGACCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGAGGTGGGGAGAAGGTCCGTGAGTTTCCC
TGTTTTCTCTTGCAGGCTAAAGCTTCAGATAAGGACAGCGACTCTATGATGCAGACCCTA
TTGACAGTGACCCAGAGCTTGGAGTTCTCAGAGACACCAAAAGCCTCAAAGGCACCAGAA
GTCTCAGAGGCTGTGAAGGTCTCAAAAGGCCCAGCAGTTGCAAAGGCCACAAAGGTCTCA
AAGGCCCCAGAGGCTCAGGAGGCAACTGCCGCCCAGGCTTTACCCACCACTCAGCTGACT
GATACCCAGGTTCTGGCAGCTGAAACCAAGAATCCAATAGCTGACACCAAGACACAGAAT
GCTAACCCACGGTCTGTGACAGTGCCTGCCACTGAGACCAAAAAGGTCAGCTGTGTGACT
GATACAAAGGTCAATACGAAGGCCCCAGAGACTGAGGTTACTGCCTCTCAGTCTCCTAAA
GATGAACCTGAGCCTGAGGGTACAGCTGCCCAGGCTCAGGAAAATCAGGATACTCGGCCC
AAGGTTAAGGCCAAAAAGGCCCGAAAGGTAAGACCTCTGCAGTCATCACCCTTATTTTTC
CAGTGTTTTCCCCTCAGTTAATTGATTTGTTCTATATAAGTTTAGAAACATTTCCATGCT
CATCAAGGCTATGGTGGCACTGAGAAGAATGTGGTACAGTTTCTGTCTTCAGAGAGCTTA
TAGACTTGTGGGAAGACAAGATTGGAATATACATAGCTACAATCTGAATGTAATGCAGTT
TATATTTACATAGTAGCTACTCCGTGTTAAGCCTTGTAGCAGGCACATTCATACATGTTA
TCTCATTACGTCCCAGTTTTTTATAGAGAAGGAAGCTGTGTCCCAGAGAGGTAAACTGAC
TTGTCCGAGGTGGTGTAAGCAGAGCCAGTGGTGGACATAGGACAAGGAAAAGTCTCATAC
CCCACCCTTAGCTTGCTCCTGGCCTGGTTTGGAGATGAAACTCCTGCCCCGAAGTCAGGG
AAAAACAAATCTAGGACTTAGCATGACCAATGTCTAGTGAGGCAAGCTGTTAACACAGGG
GTGGGATTATGGAGGTACTTCCTAAAAGAACTAGGGTACGGAAAATGATCACCTTTTTCA
TCTGGTGATGTTGAGCTTCCTCTGTTGATGTAGGTGAAGCATCTGGATGGGGAAGAGGAT
GGCAACAGTGATCAGAGTCAGGCTTCTGGAACCACAGGTGGCCGAAGGGTCTCAAAGGCC
CTAATGGCCTCAATGGCCCGTAGAGCTTCAAAGGGTCCTATAGCCTTTTGGGCCCGCAGG
GCATCAAGGACTCGGTTGGCTGCTTGGGCCCGGAGAGCCTTGCTTTCCCTGAGGTCACCT
AAAGCCCGTAGGGCAAGGCTCGCCGTAGAGCTGCCAAGCTCCAGTCATCCCAAGAGCCAG
AAACATCACCACCTAGAGATGTGGCCCTTTTACAGGGGAGGGTAAGAACTTTTCCCTTTT
CACTTTGCCTTTTCATTGTGTTATCTGCCCTCTTCTCTGTCATCCTCAAGTTTTCTACAG
ACTTATTTTGATCTTTCCATACGTTCCTCCTCTCCCAGGCAAATGACTTGGTGAAGTATC
TGTTGGCTAAAGACCAGACGAAGATTCCCATCAAGCGTGCAGGTAGAATCCTGTTGCCCT
CTCCCCCAGTCCTGAGCTCTGTTCTCTGTTGTCCTCTCCCCCATGTGCTGGGGGCATTCT
TTGTTCTTTATGCTCCTATCTTTGTCTTCTCAAAGTTCTAATTTTTCAGTGCTAACATCT
CTATTGATAAGCTCAGAACCTGGTTATGTCACCCATGGCAGAGTTGGCAGAGAGTCTATA
CTTTGGGCATGAGGACCACCTAGTGTCTCTTCAGTTCAGGTGCTTGCAACGCTCTCCTCT
TGCAGACATGCTGAAGGACATCATCAAAGAATACACTGATGTATACCCTGAAATCATCGA
ACGAGCAGGCTATTCCTTAGAGAAGGTGAAGGGGCACTCAGCGGGGGAGGGGGATGGGCA
CTGTGGGGAAGCCTTGAATGCAACAAATATCTGTATAGTTCCTTCTGGGGGGAACTGCAA
AGACCCACTAATCCAGCCCTGTCACCATGCAGATGGGCAGAGAGTGGCCTGGGGTGGGGC
ATAGACTAACCATGGGTCACACAAAAAGTAGTGGAGGCACATCTGAGACCCAAGCCATTC
AACTCATCCCTGGCTTCTGTCCACTTCTAGACACATCCTGTTGTGTATTTTAAATGTTCA
CTTCTCCCTTCTATTCTCCATTCTACATCTCCCTGGACTCCCACTTAATCACAAAGATGA
TGTTGACAGTTTATGGTACATTTATTGTGTGCTTATCTATGCTAGTCACTTAGTGATGCG
CTTTATGTGCATGATCTCACTGACTTCTCACACACACAAAACCCCTAGGTACACGGGGAG
CTGCAAGATGTCCAGAAAGCTGAATTTTGTGATCTCAAAAGCTGTTCTCCCCATCCACAG
GTATTTGGGATTCAATTGAAGGAAATTGATAAGAATGACCACTTGTACATTCTTCTCAGT
ACCTTAGAGCCCACTGATGCAGGCATACTGGGAACGTAAGCTGGGGAAGGGTTGGGTGGG
AGGGGCTTCTACTTTTGTCCGTGGTAATACCCCCCCTTTCCTCTCTCTCACATCCTCCTA
GTGAGTCAGGAAAGAAAGGGCTAAAAGGCCTTTGTCCACCTACTGAGAGTAGTTGGGCCC
TGTATGCATAGTGTGCCTGATCATGCAGGCTGGAGATGTAGAANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCTAGCCTTGGTAAGTGGTTCTCAAGGAGGACTTCCTG
GTGTGTTAGGTTATGTTGTTGGAAGCATAGTCAGTAGGGCTCTACCGAGAACTACCTGAG
GGTTGAGGGATCTGGGAGAGAAATAAGAGGCTCATGTTGCCTGTTTTGTATGAGATTAAC
AGGCATTCTTCCATCTTTTCAGCAGCCTGTGGACAGGAGGATCTGATTTTCCTGTTTCAC
TGCGTAGGAGACAGCTCACAAGTCAGAGTGCCTTTCCCAGGGTCACACAGAGCTTGAAGC
AAGACTGGGCTATTTTATGCCTATCTGAAGAGTCTGAGAGAGGCTAGCCAACTGAGCCAG
TTGCTGTGTCTTATGCAGATGGCTACTGGACATAAACCTTCTCTCTGTGCATTACTCCCT
TAGAACCAAGGACTCACCCAAACTAGGTCTCCTCATGGTGCTCCTTAGCATCATCTTCAT
GAATGGAAATCGGTCCAGTGAGGGTGAGTGACAGGTCATGTGACCGAATGGGTGGCAATG
GTCTGAATTCCACGTATTCATTTTCTATCCCTGTTTCCTTTTGCCTTACCTCACAGCTGT
CATCTGGGAGGTGCTGCGCAAGTTGGGGCTCCGCCCTGGGTATGATTGAGCTCTCTCAGT
GCTTGCTGTCCATGTTGTCCTTTGGCAAGAGAGGATGGTTCCAGGATTACATCAGCCTGG
TGGTCTGGTGGTGCAGGCAGGGCGGGTGCTGAATTGGGTAGAGGGCCCAGGGTTGTAACC
TGGGTGGATGGGGAAATGATCCTGAACTCTTCACCCTTTCTTTCACTGTCTCTTGGGCTT
TCATGGATTTTCCCTCTTGTGTTGGAAACCTCTTTTCCATTTTAAAAATGTCTCTGCTCA
CATCTAGGAAATTCCACAATAATGATTGTATTTACTTCTTTATTTTTATTTCTCTACTGT
TAGGATACATCACTCACTCTTTGGAGATGTGAAGAAGCTCATTACTGATGAATTTGTGAA
GCAAAAGTGAGTGTCTGTGTAGTGGCGTGCTTCATGCATTTTGCCTATTTCAGAACTTAG
TGCTAAACTGTACGTATATGTGTGCACACATGTGCATGCAAGTGGTAGGTTATTACTGGG
ATGGTGACAGAGAACAGAAGCAGCACATGCTTCCTGATCTATTACATGCACTCTCACATT
TGTCTTCAGAACAACTCCACAAAGGAGGGGTTATCACCACCAGTATTTTACATATACAGA
AACTGAGGCTAAGAGAGGTGAAGTCATTTGTTCAGGATTACGCGGGTAGCAAATAAAGAG
TTGTTTTTATGGGCCAGCAGGTGCATGGTGTTAGGTACTGAACTCCCACATCACTGACCA
TGTCAAACCCTGGACTAGCGGCTGAAAGTCACACTGGGCACATGTGCATGCTTTCCCAGA
ATCCCGAGAGATACTGAGGAGAAACGATGGGCATGACATCCTCTGGGGGTGACTCTACTA
CTATCCTACTCTCTCTGGTGAATGGACATGCCTATGGCAAATCTAAAAATAAATAAAAAA
AAGATTGTGTGAGACTGCTCCAAATCTGGTTCTTTTTACTAGAGTGTAACCAGAGCTTAA
GAGGAATTAATTTCAATAAAAGAATGTCATAGAATGGTAGCTTCAGGCAGCTGTGTTCTG
TGCTAGGGACTTGACTTGTACATCTTATTTCATTCATCTAACTACCCTGCAAAATAGATG
CTGTCATCTCATCCCTGTATTTTTGTTGTTTTTTTATTCTTTATGTCATTACTTTTATTT
TTAATGTCCAGAGTTTGTAAGACAAGGGCCAGAATTTCCTTCTAGGAACAATAATTTTAT
AAATTCTCAATTAACTGGTGAGGCCAAGAGAGCTATTTCTACTTGTCTAATACAGTTTAT
TGGAAGACTTCATTCAAGTCCTCAATGGTCATCTGGTCAAATGGAATTGTATTCTTCATC
TTCTCCAGCCATTTCTGATATTCTTCAATCCTGGCCTTTGAGAATGACACAAACTCAGCA
CAACTTTTCACCTTCTTTTCAAAGTTATCCACCAAGCATGCCCTAGTCACAGTGACCTTG
TAATAAGCTCAGTCCAAGGTCTGGCAGGTGGCATGGTTGTTAAGGGCACTGGACTCCCAC
ATGGTCGACCACGGTTTGAGTCCTGGACCTGGCAGCTTGCTTTCTCACTTAGCTCTTTCT
CTCTCTCATTCTGTCCCACTCTGGTCTAAATAAATAAGTAAATAAATATGGTTAAATAAA
ATAATTTTAAAAAATAAGCCCAGTCGATAACTGGCAGGTTCTCAGGTAGTGCAGTCAACC
TTGAGGTAAGGGTCTCATTCCGTGTTTTCAGGAAGTTAGCAATAGCCTCTTAGTTTCAGG
GTATTATTTCCCCAAAGCTACCCAGTCAATAGTTTTTTAAAATTTATTTTATTTTAATTT
CTTTTATACATTCAATCACATGTATTGCTTAGCTTGTAAAGTGAATATTCCAACATGAAT
ACATTTCTTAACAGTACAGTTGGGGATACTATACAGTTACTGTTATTTTTAAGAGAGATT
TTTGCTATAGGACACATGTGCTTGCCAGAGAGACAGAAAGCAAGAAATCACTCCTGCAGA
GGGGATGGCCACACTGCAATCCCTTCTCCTCCAGTCTCCTCTAAGGATTTTGAGCACACA
TGGACATAGGCCCAGCCTGAGTTTTAAGTCACCGGGTCCGGGATTTGAACTGTGGCCAAT
TACGTGGAAGTCCAGTGACATAACTGTTATGCCGTCTGCTGATCCCCATTCCTGTTTTAA
CAGTTGTGAGAACCGGGTCTCCAAGAGGGAAAGTCTGAGTCTGGCCCACAGCTAGTAAGG
GACCAATTCATGACATAGCCCTCTTGACTTTTAGGCTAGTGCCCACCCTCTCCTTTGTCC
TTAAAGAACATGCGTGCTGTCACATAAACACACATATGCATGCAGAAAAACATACCCACA
GGGTTAGGAATGCGGGTGCATGTATGGAGCATTCTGCTCTTGGCTGCTTATTTCTTTTCA
GTTGTTTTCTTTGGTGGATCTTTCCAGGGTTTGGCCAGGTTGTGAATGAGACCCTTGTGA
TGTGATATACTGAGTAGGGGGCCTGGAGAATAGCTCTTCTGTTTATAACACACCCAACAG
GCATTTTGGGTCACTGTGATGAGGGGCACAAAATGTGTGGCCTCCCTGTGAACAAATGTC
CTAAATGTGTCCCCCTTACACCTTCATGTGGCTTCTGAGCAGGACCAATGGGACAGGGCT
CAATATTGTAAGAAAACCAGCAGTATTATGTGGGAGAGGTTGCCACCTAGAGCCTGTCCA
GTCCTGCATTGGAGGAAGGGATGGAATGAGTAGTCTTAGAAATAAAGGCCTTGAACCTTT
CTCTTCAAGGTACCTGGATTATGCCAGAGTCCCTAATAGCAACCCCCCTGAGTATGAGTT
CTTCTGGGGCCTGCGTTCCTACTATGAGACCAGCAAGATGAAAGTCCTCAAGTTTGCCTG
CAAGGTAATTGGAGAATTGCCTGAGGTTGGCATTTCAAGGGAACATAGTGCCCTCTCTGG
GACAGGCTATGAGCATCCTACAGTTTAGGTCTGAACATTCTGAAGTCTCTCTTAATTGCC
AAACATTGTTATAACTAATGTGAGGGAAATTTACAGAGTTCATGGGAAATGGAATTAAAG
TATGAATTTATTTTGGTGCCAAAAAATTTTTGAAATCAGTGCATGATTTCTTTCATGAGA
TATATTTTCCATGACCTTTTTGAAGAACTTATGTGATGGGACCAGCAGTTAGCATAATGG
CTATGTCGCTGGATTCCCATGTAGTTGACCACGGTTCGCGTCCCAGACCCGGTGGCTTAA
AACTCAACGCTGGGCGTGTGTGCGTGTGTGCCCAAGATCCTGAGAGGAGAATGAAGGAGA
AGGGATTGTGGTATGGCCATCCCCCCGGGGGGTGATTTCTCACTTTCTCTCTCTCTGTCT
CTCTGTCTGTCTGGCGAGCGCATGTGCCCTATAGCTAAAACCTCTCCCAAATAAGAACTT
ACGTGTCATTTGATCTTCTGCAGATGATATATCTATAGCCCAGAGAGTTTGGTAGTTGAT
ATGTCCAAGGTCACAGAGCTAGTCAGTGTCAGAGCATAGGACGGAATATTAGAGGTACAG
AGCATGGATAGAGTATTAGAGGTATATTAGGTGCCTACCTATTAGTAGGGTACTTCATCT
AAACTTCATTTATGATCGTTCTGATGCTCATTATTTCCATTTCAGGTACAAAAGAAGGAC
CCCAAGAATTGGGCAGCTCAGTACCGAGAGCCAATGGAAGCAGATTGAAGGCTGCAGCTG
AAGCTGCAGCTGAAGCCAAGGCGAGGGCTGAGATTAGAGCTCAAATGGGAATTGGGCTCG
GCTCTGAGAATGCTGCTGGACCTTGCAACTGGGACGAAGCAGATATTGGACCCTGGGCCA
AAGCCCGGATCCAGGCAGGAGCTGAAGCTAAAGCTAAAGCCCAGGATAGTGGTGGTGCCA
GCACTGGTGCCAATACAAGTACCAGTGCCAACGCTAGTGCCAGTGGTGGCTTCAGTGCTG
GCACTGGCCTGACTGGCACTCTCACATTTGGGCTCTTCACTGGCCTTGGTGGATCTGGTG
CCAGTAGCAATGACAGCTCTGGTGCCTGTGGTTTCTCCTACAAATGAGATCTCAGGTATC
TGCCTTGGTTTTCATGGAGGCAGCTGGGGCTGATGGGGATGGGTGAGGAGCTATATTATA
ACAGAAAGGTCCAGGGTGAAGAATACAGAGAGTGTGGGAAAATGCCGTTTTTGGCATTTT
ATTCCTTCCTGTTTGGTGGCTATCAGTTGACTTCATAGTTTATNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGG
GAGAAGGGACTATATAGACAGGCCTGTGGAAGGATGAGCAGTAGGGAGGTCCCAATGGAG
GATGGAGGCCTTGTTTTGGGGGAAACATGGTGAAGTGCTCAGTTAACTATTTTTTCCACT
TACCTTAGTATAGGAACCAAGAAGAGTATTTATTCCAAAGTATAGGTTTTGCTCTTTGAG
TCTGGAATAAAGACAATAGACCAAGGGCAGTGAGTGCATGAGTTTACATCTTCATTACTT
CTTTATCCAGGATGTTTTATGGTAGGTATACAAAGTGGTAGAAAAGATGGGCCCTGGGAC
CTAGAAAGGCTTGGAGGAAAAGGACTAGTAGAATATGTGATATGTTAGAGGGCAGTACAG
GCATTTGTGGACAGGAGTCTCAGTGAAGTCCATCAATGGGGCTACAACATCAAATGAATG
TCCTAAGTGCCTATTACATATTTAGCAGTATTCTCGGTATCTGGTAAAGGGTATTGAGAA
AACTAGAAGGGTGAACTGTTGGACTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1995..2486, 3093..3308, 3311..3400, 3518..3581, 3845..3924, 4440..4534, 5223..5302, 5396..5438, 5763..5825, 8229..8343, 9105..9161, 9164..9526
1001..1045, 1995..2486, 3093..3308, 3311..3400, 3518..3581, 3845..3924, 4440..4534, 5223..5302, 5396..5438, 5763..5825, 8229..8343, 9105..9161, 9164..9523
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved