Tupaia_belangeri Locus ENSTBEG00000005733
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000005733
Tupaia_belangeri
ENSTBEG00000005733
GeneScaffold_4804
SNORD42, SNORD42
1529..1592, 5599..5661
7044
ACCAAGATTCCTTCCCCAGTGGAATATAAAGAGGGGTAGGTGGACTGGGGAACTCTACT
TTTTAGTTTGGTCGCCGCCCTGGGACACAGGGACTGAGTGCCCTTTGATTATGAGTGACT
GGTCACTGTCCTGGCTCCATTGGAATCTTTCTCCCAAGGGCATTTTCTTTTTGCAAAACC
TTGCTGGGTAGGAGAGGGGGGAGCCCATAACCAGTTTCACTGTCTGGTTCCATGGACAGC
TGGGGAGAGTTAGGTACAGATGCTCAGCCTTGATCAGTATGAAACCTTGCGGTGTCGGGA
ACCGAACGTGAGAATGCACAGCTGACTGGGAAAGGGAAGAGAAGACAACCTGCGAGGAAG
GAACTGAGGGAAAATTCTTCATAGGAAGAACTAGCGAATCCAGGAACAATCTGCTCTGGG
TGTTTGGAAAACCGACAGAACTTTGAGAGTATTATTGGAAAACCACAGCGTGGCAGAAAT
TTCTCCCTTGACTGTCTGCCACCAAATCACTGTGCTCTGGATCATCCCCATTGCTCTCTG
GACCTCAGTTTCCACAGACAACCGTCTGAGGGAGTTAGACCAGGCAGATCTTGTTCTAAC
GTTCTAGAATTTTGGTTCCTCCTCCCTGAGTCCATCGATATTCTTTCCGGTTTACAGTGT
CGTGGTCTCTTGGCACTACAGTCTTTTCCTTGACACTGGAAGTTGCTCAAGATGGGAAGC
ATCAGGGACCAGGCTCGAAGCAGCCGCGTACACCTTCCACAAGCCTGAGCGAATAAACAC
GTGTCTTCAAAAAACTACAACTTCCAAGAAGCTTTGCTGCCCTTTTATGGGCGGTGTAGC
GCATGCTCGCTGCCATTCATAAAGGAAATCTAACTACCGTTCCCAGCAGGCACTACGCTA
CAGATTAACCAATCAGTTCTCAGTAGAAAACATCGCGAGTCTTCGGGGAGATTTGATTCT
ATAAGCCTGTGGGACGGACATCGAGGGTCCTTTTCGCCAAGATGGCGCCGAAAGCGAAGA
AGGAAGGTGTGTATTGGGGAATAGGGCTTACGGCGGGTTTGTTTGGGATCCCAGTGGAGC
AAATGTGTGGGGACTCTTCGGGTCTGGTTAAGTCCTGAAAGGTCTTACCCGGAGCTGCTT
CTCGTGCTTGGAGCACGCTGCGGCGTATGTGAGCCGCGTGAGCTCGGCCGCGTGGGCTGG
GTTATATTGAAGGAAGTTAGGGAAGCAGCTTACCCGGCCGTCAGCCACTAGCGAGAGCGG
GACATTCATAGGGATTTGGGGAGCTGCACGCATTCACAGGTCGGCTTCAGACCTGTGAGG
AATCAGTACCCTCAGCTATACTTTTCTTAATCCGGGCTATATACCCCTCCTGCCGCCGGA
GTTTTTGCGGTGTAACTACAGTTTTGCGATGGTGTGTTGTAGAACTAGCGTTATGTCCTG
GCAAGTATCAAGCGTTCAATCAGTGCTAGTTCATTTCTTTGTCATATCTTTGGAATTAGA
CCAAGTTGATCACATTCTCCCCAAGTACCGTGCATATGATGGAAAAATTTTAATCTGACA
CTAGTGATGTCTTCAAAGGAACCACTGATGCACGAGTGGCCAGGGGCACCCACTACGTGT
CTTGAGGTTGGAAGTGGCCGATTTCTGAATCCTTCAACTTCGTCATCTTTTTCTCCCAGC
TCCTGCCCCTCCCAAAGCTGAAGCTAAAGCGAAGGCTTTGAAGGCTAAGAAGGCAGTGCT
GAAAGGCGTCCACAGCCACAAAAAAAAGAAGATCCGTACATCACCCACCTTCCGGAGGCC
CAAGACGCTCAGGCTGCGGAGGCAGCCTAAATATCCTCGGAAGAGCGCCCCCAGGAGAAA
CAAGTCAGTACTGCTTCTATACCTATGAAAAGATACTTGAGTAGCCTCTGTTGGTGATTA
GAAATTCACCCACGTTAGAGCATGGCTTCTCAAACACATTGGTAACCCATTGGTCTTATT
TAATGGGCGTGTGAGGAGGTTGTATCTGCCTTATATGAGAATAAGGAAGAGGCCAGTAGG
TGGTATGATGGTTAAAGCACTGGGATCCCACATGGTAGATTGTCCTGGACGTAAAGAGTA
ACAAATTTCTGCAGTACAGGAGGCCATTTTGTTTAGTCTATTAGACTTATTATAGCATCA
CGTGTGGTGAGGATTTGAAAGTTCACTTTCCTGAGAATATGACGTGAAATTAAAGTAACG
CTCTTTATCTTGGAGTTCCAAGTTTAGTTCCTTGCTAGGACCTAATGCTATAGGGAACAT
TCCTTGAGGTGAGGAGATGTGGGTTGAATGATCATGTGGCCTGACTTACCTATATAGAGT
AGTAATGGCCTGCAGCAGTGTACAGAAGCTTCTCTACTTTCCCTAATTTTCATATTACTA
AAGATACTACTCAAAGCATAGGTTGGGGAAGTGGGTAAAGGTTTTGGGCAGGTGGATATT
TTGGCGTCAAGCTATTCATAATGACTGACTTCTTGGGAATCATAAGAGCCATAGTAGCAG
TTGCCACAAGTGGGTTTCTGCTGCTTCCTAAGAGAAGAGTAAGGGAGACTTGTGTCCATG
GAGGAAAGCAGTGGACAGATTATTTACTCACACCCCTGTCCTACTTGCTTGGACCTAGAA
TTTAGCATGGTACATGATGAGGCTTCAAAATAAGACAGTAGTGCCCGGGTGAGCAGAGCC
TGGCTTCTGTACGTTGTGGGATGAAGCTGTGTTCTGGCTATGTTAAAACCTTCATAAGTT
TAACCTGAGGTAAAAATAAAAGTTGCTGTCAAGAATAGGTGGTCCTTGCTGCCAATTCCC
TGATGCAGTGGTAATATGACATGATGCCCATGTTTCAGATCCCTACCTGTTCAGCCTGAA
ACCTGTCAGGCACATAAGTGGCTGGCATGACCAGATTTGAGTGGAAGGTGCTAAGATCTG
TCTATCCTACCTCCTGTAAACATGTATTTTACCATTAATAAAGAAGAAAAATTAGCGGCC
TTCAATCATACAGCTATTTTTTGCAACAAGAGAGGGTAATGTTTGATCTAACCTGAGTGA
GGCACTAACATGAAATGAGTTCAGATTGAAGATTTTTTTAATTTGCACGTGCTTTCTGTA
TGTATGTGTTTATGTACGTATCTTAATTTGCCCAGAGAAGGACAGAGAAACGGTGAGAAA
AAGCAAGCTGCCGGGTTTGGAACTCAAACCAGTGCCCTTAACCACCATGCCACTTGCTAG
CCCCCCCCCCCTTTTTTTTTAAGAGATTTTTGCTATAGGGTGTGTACAGCATGTACTCAC
TGGAGAGATGCAGAAAGTGAGAAATCATGTCCCACCCCCAGGGGTAGGGGTGGCATGCCG
CAGTTCCTTCTCCAGTCTTCTCTCAGGATTTTGGCCACACACGGGCCCAGTGTGAGCTTC
AAACCTTCAGGTCTGGGACTCAAACTGCAGTAGGTCAGGTGGGAGTCCAGCTACATAACC
GTTACACTATTTGATGGTCCCTGCATGTGCTCTTATTATGAAAAAATGGGGAGGGGAGAA
AGCAACCCCCAGGAGGATAGCTATACTATAGACCTTTCTACTCTGTTCTCAGGGTTTTGG
GGACACAGGCATAGGTGCCCAGCATACTTTTTTTTTCTTTTTTAAAGAGATTTTTGCTAT
AGGGTACATGCACTTACCAGAGACACAAAGTGAGAAATCACACACACACACCTGTTGGAG
GGTATGCCATAATCTATTTCATTCTCTCAGTATCTTGGGCACGCACACGCATCCGGCGTG
AATTTTAAGCTGCTGGGTCCAGAACTCGAACTGTGATCGACTACATGGGAGTCTAGTGAT
AGAACCATTAGGCCATCTGCTTGTCCCCACCTGGCGTATTTATCAAACTGCCAGGTCCAA
GACTTGAACCACACAGTCAACTATGTGGGATCCAGCCACTTTAACCACCATGCCAACTGA
CTGGCCTCAAGGCAGTTTTTTTGTTGTTGTTGTTTTTTAATTATTTCCATTTGCTGTTGT
ATCAGAGAAAGAGAGAATAGGGGTAACGAGAGCAAGCTGCCAGGTCTGGGACTCGAACCG
TGGTTGGCCATGTGGGCAATCCAGCACCCTTAACCACCGTGCCACCTGCCAGCCCCTCAA
AGTAGATTCTTTAGTCACTTAACGAGATCCTTTCAGGTGAAAGAAAAATACACTAAAGGG
TTCTGTTGCTTCTTAACCCCCACTCCCTCACGCTACGGTTTCAGGGTGCAAATGATGACA
TTATTCAGCGACCAAAGTCTGACAGAAATGATTGCTTCTCAATGTCTGATGCACCTCAGC
TCTCCTGGTCTTGGGCTCAATGAGGACCTGTCCTTTCTAATACTGGACTTAGGTCACTCA
CTTTGCTTCTCCCCCAGGCTGACCACTATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAAAGCGAGTTTGGCAAAGTCCCTGATGATGCTCTTAGGGCAGAAGTC
TGTACTGTACGAGCTTTGGGAAATGAGCACCCCTGCTGTGATATAGTGCTTTGTTTGCAG
TGTAGACCTCAGGAAACTGCCTTCTGGGATTTGGTTTACCCAGTTGGTGCTTGTTTTCTG
GATCCCTACCATGGTTTATGTCAGATTACCTGGGTTTAAGTCTTTTTTAAATTCACCAAA
GTGGTGAAATGAAGAGGCACTCCCCCAAGGAGGATGGTCACATTGCAGTCTCCTCTTCCT
CCACTTTGAATTTTGAACATAAACATGCACATGCCACAGCATGTTTTCTAAGCTGGCAGG
TCCAGGAGTCCAACCATGCAGCCTGCCATGTGGGATCTAGCCACCTCAACGACCAGCCTC
AGGCTAGCCCAGGTCTTTTCAAAGGTTTTTGTCATAGGGCATGTGTGCTCACCAAAGAGA
GGCAAAGGGAAAAATGAGAAATCACCCCCTAGAGAACAGATGACCACGCTGCAATCCCTT
CTTTAGGAATTTTGGCCATGTGTGCACATAGCTTAGCATGATTTTCAAGCAGCCAAGTCT
GGGACTCTGGTCAGCCACGTGGGAGTCCAGTGCCTTAACCACCATGCCACCTGCTTGCCC
CCAGATTTAAGTCTCAAATGCCCTGTAGTGTTTCTCCTTGGGAATTGGTTCTGTGGTTTT
ATGGCTCCCATAACCCTCTGCACAATGATGGAAACAAACTATTTAGAAGAGAATGATATG
AACAAAGGAACCACTGATGTGCCAGAGGAGTGGGGAGGAAGCCCCATCTGGGGACAGGGA
GAGCAGCCGAGCCTAATGCTTTCTTCCTCACCCCAGGCCTGTTGGAGAGAAGATGGCGTA
TGTGCGACTGGCTCCCGATTACGATGCTCTGGATGTTGCCAACAAAGTAAGCTTTCTTCC
CTGCTCTGCTTTTCCACCACCTACCCCAGTGCTGGTGATGGGCCTGTTAGTGACCAAAGC
CTAACTTGTGCTGATTAGTCAGAACTGACTGAGTGCACTGTCTTCAATAAGACTTTACCT
CGTGTGCCCTCTTTGTGCTTTTTAACCATGAAATTCCATCTTAATCTTCACATTTCAGTT
CCAGTAACAAAGCTCCTTTTTGTTTTCCAGATTGGGATCATCTAAAGCAAGTCCAGCTGG
CTAATTCTAAATACACATTTTTCCACCCTATATATGCTTCTTGTGTTTCTGGTTGGGCTG
GCGGGGGAAGGGACAAACTGGTGTGCACTGAGGGAATAGGGTGTGGGCAACACCCTGATC
CTCCTGCTCTGTGGGAACACTCACCCATCACTTCACTGTACTTGTTAAAAATCCCAGGTG
GTAGAAGCTCAGGTTCCAGAGACATCTCTGACTCAGACTAGGGTTAATTGTCCCAAGATA
ACAGGCTTTACAAGAACACCTCCCTTCATCCCTGGAAGAGGCTGTATGTGAAACCAGTAC
CCAGAGTCAGAGGAAGAGAGTTTCAGGCTTTTCATTAGCATCCATTTCAGGGCAGTGTGG
GTTGGCTGCTGTTGGGGTAGCACCTGTCTTCACACCCATCTACCGTGTCCAACCGGTCTG
TCTGCTGCTCACCCCTTGCCCAAGAAAGGACAAGGACTTCAGAGTACATTAGGGTTTTCA
ATAGTGGGTGCAGGCCTGGAAGGCAGAGCGGCTGGTCCCAGAGGACACGGCCTTGGAGCC
AAGCCCCAGTTTGTGTCTCCTTGGTTGTCGTTGCTGTCCTTGCCACAAACGCCAGGCTCT
GCACTTCTCACTCAGTCAAAAACTTGTCTTTGTGTTGCCGGCTGGGGACACGCTCAGGGC
AGAAGTCAGAACGGAGTAGGCGAGAGAAGTAGATGAGGATCATCACGTCCAGCATGAGTA
GGATGCCCAGGAGGAAGGTGCCCAGGGTCCTCTGGCCCGCATAACCCAAGAAGAAGTGGG
TGAGGTAGGCCTGAGGTGCCAGGCGAAAGAGAAAGTACATGACCAAGTTGACATACTTGT
TGACCCGGTAGAGGAGGTGGTCCTGGGCGTTGCTGATCTTCATCATCATGCGGATGGTGA
GGAAGATGTTGCTCACCTCCACCAGCAGCGTAAGGACACCACCACCAACAAAGCTGCGCC
AAAAAATGCCTGAGAAGAAGGCACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1679..1862, 4397..4397, 4400..4410, 4561..4722, 5736..5805, 6030..6044
1001..1025, 1679..1862, 4397..4397, 4400..4410, 4561..4722, 5736..5805, 6030..6041
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved