Tupaia_belangeri Locus HSPA9B
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri HSPA9B
Tupaia_belangeri
HSPA9B
GeneScaffold_1806
SNORD63
31036..31112
37837
TCAATAAATTCTTTCTCTTAAAAAAAACCTGGAAACGGGGACCAGCAGTTGGCATAATG
GCTATATCCCTGGACTCCCATGCAGTCAACACAGTTCGAGTCCCGGACCAGGTGACTTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGGTAGTCTGTGGTCAGGCAGCGCGAG
CGGCGCCTCAGCGGAAGAGCGGGCTCCGGGCCGCAGTGATCAACCCCCGCCCCTCACCCA
CGTGGTTGGAGGTTTCCAGAAACGCTGCAACCACCGAGCTGAGCAGCTCCGGGCGTTCCA
GGGCTTCTTTGCTGCTTCCTTTCCCCTCCAATCCAGCCGCCATGATAAGTGCCAGCCGAG
CTGCTGCAGCCCGGCTCGTGGGCGCCGCAGCCCCCCGGGTCCCCACGGCCGCCCGCCACC
AGGTAAGGAGCTGTCGGGCCTTGTGGAGGAGCTCACGGCCTACAGGCTCACGGGCTTGGG
CCTCAGTGCGGCAGGCTCGCCTTTCGAGATCACATTTTTCCAGGAGAGATCTGGAGGGAA
GGAGGATAACGGACGTTCCGTAGTTAGTGGTGTCTGTTAAGACCTTGTTTAGGGTTTGTC
TCCGTACCTCTGTGGCCATGCTGAGTCACACACCTCGTTATCTAGGAGTCTTCACCCCGT
GAGTTATCAGGTAGTGGTCCTGACTGCGTCCTGTGGCTGGTTGAACAATTTTGGCCTTAG
GAGTGAGGATTTCAGTCAATTAGGAGGGCGGAAGACGTGATTTTGATTAGGAGTCGAATA
TGGGTGCCCTTCCGGTACAAGGTGTAGGGTATATTTAAGGACATTGTCTTTTTTTCTTTT
TTCTTTTTTTTTTTTTTTTTTCAGATTTTCGCTATAGGGTTCGTGCGCTCGCCAGACAGA
GAGAGACAAAGAGACAGAAAGCGAGAAATCACCCCCCAGGGGGGATGGTCACGCCACAAT
CCCTTCTCTTCCATTCTCCTCTTGGGATCTTGGTCGCGCACGCACACGCGCCCGGCGTGA
GTTCTAAGCCACCGGGTCCGGGACGCGAACCTTAGTCGACTTCGTGGGAGTCCAGCGACA
TAGCCATTATGCTAACTGCTGGTTCCCAAGGACATTTTGTCTTAAAGAAGTAAAGGAAAA
AACACCTAGGCAGAAAATACATCAGGGCCTGACTATTTTCTTCGTCAGGAATGTTTTTGC
AATCTCCATTGAAAGATTGTAGTCATTCGGTTGGCATACTGGCTATGTCGCTGGAGACTG
CAGTTCGAGTCCCGGCCGGTGGCTGAAACGCCGGGCGCGTGTGCGTGCCTGCCTAAGATC
CCCAGAGGAGAATGGAGAAGAAAGGATTGCAGCGTGGCCATCCCAGGGTGGGGATGATTT
CTCGCTTTCTGTCTGTCTCTGGCGATCGCAGCGCAGTATAGCAAAACCTCTCCCCCCCAA
AAAAGGTTGTAGTCATTTGTTATTTCAGAGAAGTGAGTAAATTGGGAGAAAAAGGCAGTG
AAGTGGTTGCTAGGAGTTACTTAAAACCAAAAGTATTTGTCTTTGAAGGATAGTAATTAT
ATTTTTCTCTGCGTTTATGGTGGGGGCTTTAAAGAAGCCAGAGGTTAGGTTGTAAGGAAG
GGGTGGGTTTTTTTTTTTGTTTTTTTTTTTGTTTTTTTTTTTTTGGTTCTTTTTTAAATA
TCCTGATGGAAAGCCACTTCTTAAATCTTTAGTTTTAAATAATTTCAGAAGACTAGGAGA
CCAGCACTTTACGTAGTGACTGTGTCGCTGTACTCCCAGGTAGTCGGTGGTGGTTCCAGT
CCCGGACCGGTGGCTTAAACTCAATGCTGGGCATATGTACGTGTGCCCAAGATTCCAAGA
GGAGAAGGGATTGTGGCGTAGCCATCCCCCCTGGGGGGTGATTTCTCCCGTCTGTCTGTT
TCTTTCTGGCGAGTGCACACGCCTTATAGCAAAAACTTCTAAAAAAAAAAAAATAAGAAT
AATTTCAGAAAGTTAGTAATCCTAACTCCCTCAAACCAGCATATGATACTTCAGGGGAAG
TATCTATGGATAAATTAAGTCTATACTTAAAGTGCACGTGTATTTAGTCTGAAGGTATAG
TGTTCACAGTACAAAAGAGTAGTGTTTTGTAATGCAGTGGTTTTCCAATTAGGAGTAATT
ATGGCTTCTGGCAATAATGGGAGACAGGTTGTCATAATTTGGGAAGATGTATGTACTCCC
TTCTAGTTTGAAAAGGCCAGGGATGCCCCCTACAACAAAGGTTTGTCTTGAACAGTGTCA
CTGCTGAAAAACTGTATTGTAATTCAAGACAATTTTTTTGTATTATAGTTCAAGGCAATT
TTTCATGTTTATATCTGGAAATTTTAGTAACTCTCACTAAGTACTTTACAAAAACCATGG
CAGCAACTCAGCAGAAAAATCTGAAACTTTCATATGTTCTTCTGAAGGGTGACTGGAACA
AACCCAAGTTTTCTCATGTAGAGGGGAGCTGATGCAATTCTTTTCCTTTCTAGGATGGCT
GGAATGGTTTTAGTCATGAGGCTTTTAGAATTGTCTCAAGGCGGGATTATGCGTAAGTAT
TATTTTGTTTCTTTTGAGAGAGAATATACATGCCCTTGAGCAGTGGTTGCTGTATTTCTG
ACATACTGTTCTTTTATATAACCATTTATCTGTTTTCATTTGCAGATTATGTTATAAGCT
AATAGCAATTCCTGTATCAAATTTTGAACTATTTCCTATTTATTTTTTTTAATCTTATTA
ATTTTCCAGAAAGAGAAGGAAAGGAAGAAAGTTCAGAATGANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGTGTGTTTCGTTCGTTTGTTTG
TTTGGGGGGGGGATTATTTGTGGGCTGGCAGGTGGCTAAGGGTGCTGGACTCCCACACGG
CCAACTGTGGTTCGAGTCCCAGACCTAGTGGCTTCCTTTCTCACTTTTAAGTTCGAGTCC
AGGTCTGGGACTCGAATACAGTCAGCCATGTGGGAGTCTGGTGCCCCCAAACGCCATGCC
ACCTGCTAGCTCTGGGCACCTGGGATTCTTAAATCTTGCCTATTCCATATATGGCCATTC
ATGTTTCCTATTTACTCCGTGCCACCTTCTGGGATGGTCTGAGTGATAAGGGACTTCAGA
GATTTATGGGTAATGCAGTTAAAGTATGAGTTTGAAGTCCAAGCATGGTTCTTCATAATA
TGCTTTCTCTCGGAACTTTTTAAATTTTATTTATTTTATTTTTGGAGAGGTTTTTGCTAT
AGGGAATGTGTGTGCTTGCCATAAAGAAGAGAGAAAGAAAGCGAGAAATCACCCCCGGGG
GAATGGCCACTCTGCAGTCTCATCTCTTCCATTCTCCTCTTGGGATCTTGGGCACAAACA
CACACGCACTCAGCGTGAATTTCAATCCATCGGGTCTGGGACTGGAACCACGGTCGACTG
TGTGAGAGTCCAGCAACATAGCCATTACACAAACTGTTTTTTTTTTTTTTTTTTTTTTTA
AGACTTGCTATAGGATGTGTGCCTTGTCAGAGACAGGCTGCAATTGGGGGAAATTCTCCA
TTCTCCTCTTACTATTTTGGTTATGTATACACACATACCTGCCATGTTTTTCAAGCTTCT
TGGTCCAAGAATTGAACTGTGCAGCCAGCCATGTGAGATCCAGTCAACTTTGCCAGTATG
CCACCTAATCATCCAAGATGTAGATGTAATTCTCTATATGAGAGGAAAGATTACCTTGTT
CTCATATTGAGTATGGAAGACCTGATCTGTAGTTTAAATGTCTTTTGTGTTCAAAAGTAG
ATATTTATGATGTCAGCATTAACAGCAGTAAAGTAAGCCCATTAGTATGTTCATAAGCAT
TTGTGATTTGGGACCTTTTTTGCAAAGATACAACGTCTTATCTTTTTTTTTTTTTATCTT
TATAGACAGGTATAAACTGTATTTTATGTCTTATTTTTGTGAGTTTTAGGTGCTGGAGAA
TGCTGAAGGTGCCAGAACCACCCCTTCTGTTGTGGCATTTACAGCAGATGGTGAGCGACT
TGTTGGCATGCCTGCCAAACGACAGGCTGTCACCAACCCGAACAATACATTCTATGCCAC
CAAGCGTCTGATTGGCCGACGATATGATGACCCTGAAGTACAGAAAGACATGTGAGTAAT
AAGGAAGGTACAGTTTGCAAGGGCCCCACAGAAGAATCTTTGAGTGTCTTAATCAGAATC
CCTGAAGCATCCTACTTATTCTACATACTGTTCTGAGGGAAATCCGTGTCCCTGTCAAAA
GAGTATATAACCTTCAAAAAAAGTCAGTTATTATTTGCTGTCACAGGTCATCTTTGCTCT
ATAATGACCTGGTATATGAACATTTGTGAGGGATTCTTAAACTGTGTAAGTTAAGGCAGA
TAATGGCATAGGTTCAGTCCTGTGTTGATCATACATGTATCTCCAGAAAAAAACTCTCAC
ATCATAAAGTTCGTGGGGAAATGGAATTAAAATAATGAGTTTATTTTGGTGCAAAAAACC
CATGACATTTTTTCATGATTGCTTTTCTATGAATTTTTGAAGTCTCTTGTATGCATACAT
ACACAAAACTTGGTTTTGCTTTTTTTCAAAGATTAAAAGAGCAAAAGGCATAGGTAGAGA
TTCCTGTTTTGTAAACCCTCATTGAACTATGAGTGGGAAATGAATTCTATAGGAATGGAA
TCATGAACAGCCTCTTAGCAGAATGTTTTCAGGGTCATCCATTCTGTAGTACTGCATTCC
TTTTTATGGCCAAATAATCTGTGTGGGTATATACATTTGATTTATCCCCGTCACTTGATG
GACATGTAGGTTAATTCCACTTTTTGGATATTATGAATAATGTTGCTATAAACATTTTCG
TGTAGGTTTTTATGTGGGTATATGGGTTGCGTTTGTATTGGGTAAATAGCTGCTAATGGA
ATTACTGAGTTGTGTGTTAACTATTTTCTTTTTATATGGAAGTACCAGGCTATTTTTCAA
AGCAGCTGTAAGTCTCATTTGGTTGAAAGTAAAGCTTGTTCACATTTTATCAGCATATTC
TAACATGTTACTGTTTTCCGCATATTAAGTCAATTCCTGAAATTACCATTTGTTGGCCAT
GGGTCTCCTGGGTTGGAGGATGATCATTCATGGTGTAAGGTAATCTTGCAAGCTGCACTG
GCAAGTTTTCACTAGTGTGACTTTTTGTGTCTTTCAGTAAAAACGTTCCCTTTAAAATTG
TCCGTGCCTCCAATGGCGATGCCTGGGTTGAGGCTCATGGAAAACTCTATTCTCCAAGTC
AGATTGGAGCATTTGTCTTGATGAAGATGAAAGAGACAGCAGGTTAGTGGATTTATTATA
GTTTACATCTGGGAGAATTCAAAGAACTGGGATGATTCCTCTGAGTTTATTAGCCACATA
TCCTAGTGTTCCATGAGTCTGTGGTGTTTTGTTTTGTTTTGTTTCGAGAGGTTTTTGCTA
TAGGGCACGTGCACTGGCCAGAAAGACAGAGATAGAGTCAGAAAGTGAGAAATCAGCCCC
CAGGAGGGATGGCCACGCTGCAATCGCTTCTCCTCCTTTCTCCTCTTGGGATCTTGGGCA
TGCACGCACACGCGCCCAGTGTAAGTTTAAGCCATTGGTTCCAGGACTCAAACCGTGGTC
AACTACATGGGAGTCCAGTGGCATAGCCATTACACTAACTTCTGGTCCCTGTGGTGCCTT
TTAACAACCTGAGAATGGCAAAACATCGGTACATTTCATAATTTCTCTGCTGATTTCAGT
TTATCAGGTTTGGGTTTTGGTTTTTGTTGTTTTTGTTTTGTGGTTGGGGTTGCATGTACT
CACCAGAGAGATAAGAAGTACCCCCCACCCCCAGTCCCCCAGAGACTGGCCATAGCGCAG
TCCTGTCTCCTGTCTCCATTCTCTTTCTGTGGTCTTGGGCACATACTCACATGTACCTAG
CATGAGCTTGAGGGTACCAGGTCTAGTCCTCGAAACACAGCCATGTGGGAGTCCAACAGA
ACCATTACTCCATCTGCTGATCCCTCAATTTAGCAAGTTTAGTAGTGGTGCTGGCTTTTT
TGGGGGTAAGAGGGAGGGTTTTGCTATAAGGGCACGTGCGCTCGCAAGAAAGACAGAGAA
AGTGAGAAATCACCCCCCACGGGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGAGCATTTTCCTGTGGTGTGTCTACATGTTAGATCACTGCTAAA
AAGTTGATAAATGTTTTGGTGCAAAAGAGGATGCAGTGGGTTGTCAGGCTTATGTTAATC
ATTCCATTCTCTTTTCAGTCCTATGATTGAATTTTCACTTTTTTTATTCTTTTCCAGAAA
ATTACTTGGGACATACAGCAAAAAATGCTGTGATCACAGTCCCAGCTTATTTCAATGATT
CACAGAGACAGGTAAGATTGGTTAAGTTTTTGTTTATGTTTTTTAATACCAGAGTATGTG
CATGAGGGAGTGAAGAATAAAGTACCCCCCTAGTGGGGCCTGGTGTCTCTGTAATATTTT
TTCCTCAGGATTGGGAGCATGTGAATGTGTACCTGGCATGTTGGCATCAGTCCAGGACTT
GAACCCTGGCTGGCCATGGGAGATCCAGCTGCTCTTGTGTAATGCTTGAACTGATGTGCT
ATGGGACCGATTCCAATTAGCATTCTTTTTTGGGGAGAGAGATTATTGCTATAGTGTTTG
GGCTCACTAGAGAGACAGAGACAGAATAAATCACATCCCAGGGAGATGACCATGCCGCAA
TCCTATCTCCATTCTCTCGTTTTTGGATATGCATGTACACCTGGCATTAGTTTCTAGGCA
CCAGGTCCAGGACTCGAACTACATTCAGCCATGTAGGAGTCCAACATATTATTCACCATG
CCACCTGCTGGTCCTCCATTAGCATTCTTCACAAAGTGTAATTATATGGTACCTGTGCTG
GGCACAGTGACATTTTCCTATAATCCTAGCTACTTGGAAGGCTGAGGTAGTAGGACTAAA
AGTTTGAGGCCAATTAGGGAACATAGTGAGACGCTGTATCTGAAAAATTAAATGAACATA
TGAATAAGAAAGTAATGGTACCTGGGACACAGGGTGAAAACATTATTTATTTATTTATTT
ATTTTCCCTTTTGTGTGTGTGCACTTGCCAGGGAGACAAGGAAGCAAAGTGAAAAGGCAC
TACCACTGAAGGAGTATAGCCATGCTTTAATCTCTTCATTCTCACAGGATTTGGGGCACA
TACACACACATACCAGAATGTTTATCAAGCTGTTGGGTCTGGACTAAAACTGTACAGTCA
GCATGTGGATCTAGCATCGTCACCTCATGCATAGCAAACCATAGAAAAATGCTTTTTTGT
TTGTTTGTTTTAGCTACTAAGGATGCTGGGCAGATATCTGGACTAAATGTGCTTAGAGTG
ATTAACGAACCCACAGCTGCTGCTCTGGCTTATGGTCTAGACAAATCAGAAGACAAAGTG
TAAGTTTATGGAGTAAATTCTACAGATATGTTAAACAGAGGTCTTGAACCAAGAGAATTA
CCTTAAATCATTATCTTGATTTCTTAGTGACTGAGCCTTTTTTTTTTTTTTTTTTTTTTT
TTTAAGTTCTGCTTTTAGATTTTTGCCATAGGGCGTGTATATTCACCAGAAGGGGTTGGA
TGTAAGAAGTCTGCCCCGTAGACCACACCACAATCCCCTTTTCCCCTCAGAATTTTGGAT
ATGCATGGACACAATTGGTTGGAGTTTCAAGCCACCAAGTCCAGGAGTCAAACTGTACTA
GGCCATGTAGGAGTCTATCACCTTAACCACCACGCCACCTGCTGGTCCTGAGCCTGGTTC
TTAGAATTAAAAATATACTGTCATTAATCCCCAAGGCTTGTTTGTCATTCATTTCAAGAC
CAAGCCTTTATTTATCCTTGGGTTGTGGTAATTTTTCTTTGCTTCAGTATGCATGTTTGA
GAATATTCATTTGAATATGTAGATTTTTTTTTTTTTTTTGAGAGGTTTTTGCTATAGGGC
ATGTGCACTTGACAGAGACAGAAAACAAGAAATCACCCACCCACCCCACCCTTCACCCCT
GAGGCATGGCCACACTGCAATCTCTTCTCCATTCTCCTCTCAGGATCTTGGACGCACCCG
CACCCAGCATGAGTTTAAGCCACCGGGTCATGGTCTACTACATGGGAGTCCATTGATACA
GCCATTAGGCCAACTGCTGGTCCCTGTTTTATTGATTTTTAATAATTGAGTTTTATTTCA
ACTGTGTTCATGGTGTTACCTGTTAAGATTACATGTTAACCAACATGTCACTTTTGCAGT
TACCCAATTTTCATAATTATTATATGATAGAAAAATAGTTTATCTTCATTTGGCTGTTGA
AATTTATACCCTAGTGGTTAGGCTTTGTTCTCAAGCCTTTTTCTTTTTTCTTTCTAGCAT
TGCTGTATATGACTTAGGTGGTGGAACGTTTGATATTTCTATCCTGGAAATTCAGAAAGG
GGTATTTGAGGTGAAATCTACCAATGGGGACACTTTCTTAGGTGGCGAAGACTTTGACCA
AGCCTTGCTACAACACATTGTGAAAGAGTTCAAGAGAGAGGTTAGTTACTCTGATTAATA
TGTAGATGGTGGGATACTGATCATTTCATTATTCATAGTTTTCTTTGCATTGTTTACAGC
TTTTTTTTCCCTTAGAGAACTGGAGTAACTGCATTTCAGGTTTGTGGATGGACTGAACTA
TTCTGGTCAGTGAAGCTACAGATTGGAAGAGATGAGACATAATTAAGTGTGTAGCATTTA
TTACAGTGTTGGCAAGAGGGTCTTCAGGAACTCTTTTGAGCTAGAATCCTAGGGCTGGAA
AGAACTGAAAGTCAGTTCTTTGTCATTTGTACTTACAAAGATAGGACTGTTTTGTGTTTT
GTTTTATTACTCTAGTTTAAACTATTATTCATTATTTCACTAATGCTGGTGTTCTGTGTC
TTTATTTTGTAGACAGGGGTAGATTTGACCAAAGACAACATGGCCCTTCAGAGGGTTCGT
GAAGCTGCTGAGAAGGCAAAGTGTGAACTCTCCTCTTCTGTTCAGGTGAGACATGGAAAA
TTTTAGCAATCCTGGATGTTTTCAGCTTGAATTTATTTAAATAGTGTATTCTAATGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGACCAGAGAAGGGCAGAGCAG
GCAAGAGAGAGGGAAAGAAAGAAAACAGGCTGCCAGGAACCGAACTGTGATCAGCCATGT
GGGAGTCCAGCACCCTTAACCACCATGCCACCTCCTAGCCAATCCTTGAATTCTTTTTGT
CCACACAAATCAGGTTATGTATACTAGAGGCAAATAATAATTGCCTAAGATCTGGATGAC
AGTGGCTCGTTTGCTTTTTAAGACAATGATTTTTAAATCTAAGGGATTGTGTGAGGTTAG
GATTTTTAGCTTCGTAAATCTATTTGCACTTAACTCGGTACCCCTCTCCTTGTGAATTGA
GTGGTCTCTTCTCACTTAGTAATTTGCGTCACCAGACCAAGAAATGAACTGAGAAGTCTG
GCTCAGGTTAAAAAATAAACTGAGAAACCTGGCTCAGATAGGTATGAGATATATACCTAC
CTGTGTAAGTTTCTCTAGCATCAAAGTTGTGTCAGCTTGTTTGGTTGTAGTTTTGAGGTG
AAGCTCTACTTCACTTAACCAAGAATAGAATTGTATAAACTGTGTTGGATTTGGGTTAGA
GACCTACCAAGATGGAAACCAGGACATCTATTTGTAGATTCTTAGGTGACAGGAGGAATT
GGCCTGTGATGACTTTAGTGATTTGTTTGATTACTCACAGGAAAGAGGTATTTATCAGCT
GTCACTTTGTTGATAAGATGGTTCCTGCCAGTTAACCTTCAGTAAAACCTGGTTTGATTT
TTTTTGTTTGCTTAAGTGACTATGAGGAGTGACAATAGTACATGCTCATTGCTAGTGTAT
TCGTTGCTCGTGGTCTTTTGTCCCTTTTATCATACAGAGTGTGATCATTTGCAGTATAAT
GGTTAGGATTGAGGCTGAAATATGTGCACTGGGGCTGACCATGTGGCTTAGGAGTAACAT
GCTATTTAGGAGAAGCTATATCTCACATGATGACTGCAGTATGTGTCTTGGCCTGGTGGC
CTAAATAATGCCACGTCTGTGCATCAGTACCAGGATCTGATGGACTGGAATAGGATCACA
GCATGACCAGATCCTCTGGCAATGCCCATCCCTCTCTCACATGTGCCCTCTTATGAATTT
TAAAACAAAACAAACAAACAAACAAAAACAAATACCTGGGACTACTAGAAGACGGCTTGC
AGTTCATCCCAGAGATTTGTCAGTTTGCAATGGGAAAGTGTGGAAGAGGTTGATTTTAGT
GTGGCTGTTTGCTATTGGTAGGCATATGGAGTTTTAGCATTTAGCTATTACAGTAAGATT
GTGTTGAGCATCTTTGTATGTTTGGATATTAAGTGCTTGTAAATCTGTGGGATATATTTC
TAGAAATGGTATTACTCTTGCGTAGTTTATAGTATGGTTTGGGAAGATGGACATTAATTA
GAATATTAATAGCTATGAAACCTGAAACCAGAAGTGCTGTAAAAGCTAATGGTGTTCAGC
TCTACCGTCCTTTCATGGAAGAATATTAAATAAGGAAGCTTTAATAAAAGGCTAACCATG
CTGACACAACACTGCATTGCTAGAGCTGCATGGGAGAGTCCCAAGTCCCAGGACAGGGTC
CCAGAGTGTTCTGTATACACATAGGGCACATGCCTATGTTCCTGGCTGGGGCTAGGGGAA
GATCTCTGTGAGGACCCTGTTTGGGGGTTCTATTTCTTTCTCATGAAAGAAACTTCAGTT
AAAAAAGAAAGGACAGAGTGATGAGAGACAATATGCATGGTCTGCAGTAAGTTCATGGAA
AAAGTGTATTGTATAAAAACTGCCTGTATTTCGATTGTTTTATTGCTCACCAAATTTAAA
TCATACTTTAATTCCAGTTTCCCACGAACCACCTTGAAAATATATGTGTATGTATGTTGT
GTTTTTTTCAGTCAGAGGGCACATGTGTTAGCATGAGGGTGGTGAGGGGGGCTTAATGGG
GCCTGGTCAAGCTGTAGTTCCTTCTCTGTCCTGTAGGGATTTGGGGCACATGTCCACAAA
TGCCTAATATGTTTTTCAAGCCGTTGGGACTGGGATCTGGACCACGTGGTCAGCCCCATG
GGATCTGGCTCCCTTAACCCCGGGGCCCAGGGCCAGCCCTCCATGAACTTTAGGAAGTCT
GCTCATGTATAAGGCACTAGGGCATAAAAGAAAAGGCCAGAGTGACTGAATTCAAATGTG
AGAGAATTGATAAGCATAAAAAATAAGGCTGTATATTTCAGATTTGGTGTCTATCCTAAG
TGGAACAAATCTCAGAGGAGTTAAGTAGGAGATAAAATGATCAGGTTTTGATTTATGAAA
AGCTCTCTGGCTAGGATGGAATAGAAAATTTTTGGCAGAGGGTAGTCTGAATGCATGTGG
GAAGACATTAGCTGTAACCAGCTAGTCTAGTATGAGAGTAGCTACTTAGACCGGAGTACG
ACTGAGAGGTGGTTAGATTCAAGAAGGAGGTAGGCACTACAGTACATAATAGAGGGCTGA
GAGTATGAGATTTGGAATTTCTCGGACTACTTTATTTTATTTTATTTGAGAGATTTTTGC
TGTAGGGCATATGCGCTCACTGGAGAGACGGAGATAAACAGAAAATGAGAATTCACCCCC
CCAAAGGGGATGGCCACATGCTAAGTGTTGGTTTTTTTCTTTTTTTGGAGAGGTTTTTGC
TATAGGGCATGTGCGCTAGCCAGAGAGACAGAAAGCGAGAAATCACCCCCCAGGGGGATG
GCCACACCGCAATCCCTTCTCCATTCTCTTCTCGGGATCTGAGGTATGCATGCACACGCG
CCTGGTGTGAGTTTAAGCCACCAGGTTTGGGACTCAGAACCGCAGTTGACTACATGGGAG
GCCAGCGACATAGCCATTACATTAACTGCTGGTCCCCCAAGTGTTGAGTTTTAAGCCACT
GGGTCCAGGACATGAACTGCAGTGAACTACATAGAAGTCCAGTAATGTAATCATTACACC
ACCTGCTGGTCTCAACTTTTTAACTTTCTTCCTTTCTTTATTTATGAGAGGTTTTTGTTA
ACAGCGCATATGCTCAGCAGATAGAAAGTGAGAAATCACCTTGGGGGGGGGGGGGATGGC
CACATGGCATTTTCTTCTCCATTCTCCTCGGGATTTGGGGCACGTGCTCAGCATGAGTTT
TAAGTCTCTGTCCAGGACTTGAACCCACAGTTGACTACGTGAGAGTCCAGTGACATAACC
ATACCACCATCTGCTTGTCCTATCCCCAACATTTTTTTTTTTAATTCATTCATTTATTTT
AATTTGACCAGAGAGAGACACAGAGCAAGACAAGAAAGTGAGAAAGCAAGCCACCAGATC
TGGGACTCAAACTGTGGTTGACCATGTGGGAGCGTCTAGTGCCTTAACCACCATGCCACC
TGCTGGTCCCCATCCCCCCCAACTTTTGTTTCCAGAGAAAGAGAAAGAAAGGGAAAGTGA
GAAAGCAAGCCCTCCAGGTCCAGAATTCAAACTGTGGTTGGCCATGTCGGAGTCCAGCAC
CTTAACCACCATGCCACATGTGGGCCCCGACCATTAGCTTTTATCGTGTAGAACTGTGTA
AATATGGTATCCACCTATAGAAAATTAAAATTCCACTTCTAGTGAGGGCTAGTTTTAGAT
CCTTACGGGTGCTTCTCTGTCTGTCTCTTCTAAGAAAGAAATAAAAGTGGGGCCAGTTCT
TTGGCATAGCAATGAACTACTCAAGGGAAGTCACCTCCCACAAGGGTGACTATGATTCAA
ATCTCTGGTCCAGTCAGCCTGAAACATGCTGGCATGTGTGCTACTGCCCAAGACCACATG
GGTGGGGCAACTGAAGGAAGAGAATAGTGATGTGACCAGACCCTATGAAGGTTGTTCATT
TCAGTTTCTCTCAGGCATCTGCATACACGCATGCTGTATCATGATTTCTTTTTTTTTTTT
TTTTTTTTAAGATAAAAAAAAAAGTGAAAGAAACAGTAGTATGACCCATAGAAATGTGCA
GTGGCAGAACAGTTAATCCAGTTAATCTCCCAAATAGTTTTTTCCTACTTTCCTACCCCA
CTCTTCATTGTTGGTAATTAAAATGGATTCTATAGTGTTTGTCTCTGAGGGAAAAAGAAA
TCGAATTTTAAAGAGTTAGTATTATTAGTAGCTGTTAATTAAACTAGGTCTGACCCTGTG
GCTATTAAGGTCTTCTGTCATGAGATTCAGTCTTATTTTAATCGAAATAATGAAGAAACT
TAACCACCATTGGTCTCTCTAATGACAAAAAATTAAACATTTACTTTGCAGACCGACATA
AATTTGCCTTATCTTACAATGGATGCTTCTGGACCCAAACATTTGAATATGAAGCTGACT
CGGGCTCAATTTGAGGGGATTGTCACTGACCTAATCAGGAGGACTATTGCTCCATGCCAG
AAAGCTATGCAAGATGCAGAAGTCAGCAAGAGTGACATAGGAGAAGTGATTCTTGTTGGT
GGCATGACTAGGATGCCTAAGGTAATGGGTCCATGGAATTATTCTTGTGGAAAGAAGAGG
GGGCAAGCACATAATGTATTCTTGGGACAGGTAGCTTATGTTGTGTATGGACCTGAAATG
TGGCCCATTCTGCCAGGGTAATCTGAAAGGATAAGATTGTATCCTCAATAAAGAGTTCAA
GTGTAGCAGAGGGGAATTGTTAGGTGCAGAATATCTTTTGGAGGGGGTAGCAAGATAGAT
CTTAAAAGTCAGTCAGTTTTGTGGGATTTTTAGGAACAAACTGAAGTTCAAATTCACAGC
TAAAATCTTTGGCTGTTGGGCATGTGTTTTTTCAGTCTAGTGACTGGGAGGTTTGTTTTT
CTTTTTGGGGGAGAGTTTTTTGCTATAGGATGCGTGCGCTTGCCAGACAGACAAAGAGAC
AGAAAGCGAGAAATCGCCCCCCAGGAGGGGAAGGTCATGCTGCAATCCCTTCTCTTCCAT
TCTCCTATGGGGATCTTGGGCACGCACACAACGCGCGTCCGGTGTGAGTTTAAGCCACCG
GGTCTGGGACTCGAACCACAGTCGACTACATGGGAGTCGAGCAACATAGCCATTATGCTA
ACTGTTGGTCCCTATTATTATTTTTTTTAATTTGACCAGAGACAGACAGAAAGGGAAAGT
GAGAAAGCAAGCTGCCAGGTCTGGGACTCAAAGCTGCAGTCTGCCATGTGGGAGTCCAGC
ACCTTAACCACTACGCCACCTGCCAGCCCCAATGCCTGGGAGGTTTTTACCTTTAATGTT
TCTTCAACAAAGATTTGTGCAATGATGCATTTTATTCATCAACACATCATTCTGAAAAGC
ACAGATGTGTAGAAGACTTAATGACTGAGCACAGACCTGTTGAAAGTACAGTTCCTCCCT
GGTAATCTGAATAGAACTATCTTGGGCCTGAGTTCGTTACCTTGTAATTTCCCTAATTTT
TCTTTTCTTTTTTTGGAGAGGTTTTTGCTATAGGGTGTGTGCCCTCACCAGGAAGACACA
GACAGAAAATGAGAAATCACCCCCCAGGGGGGATGGCCACACCACAATCCCTTCTCCATT
CTCCTTTCGGTATCTTTGGCATGCACACACATGCACCCAGCATGAGTTTCAGCCACTGGG
TCTGGGCCTCAAACCATGGTCAACTACATGAGAGTCCAGTGACATAGCCATTACGCTAAC
TGCTGGTCCCCCTAATTTTTCTTTTGAAGTATGTTTAGAGAAATACACACAGGAAGAATT
TAGGGTTGGGTGAAAAGTCTAGCCAGGAGGAAATATTTATGTTAACAAACTAGCCTGGCC
ACTATTCAAAAACTAGTTTTTAGAAAAAATAAACAGGAGGGAAGAATGTGCCTCACATTA
GCAATCCTATGGATTCCTCTTTATTTATTTTTGTAGAGAAGTTTTTGCTATTGTGTGCAT
GTAGTCACCAGAGAGAGAGAGAGACAGAAAACAAGAAATCACACCCCAGAGAGGATGGCC
ACTCCGCAGTCCCTTCTCGCCCCAATCCCTTCTCACATGCACACGCGCCGGTGTGAGTTT
TAAGCCACTGGATCTGGGACTCAAACCGCAATCAACCATTTGGGAATCCAGTGATGTAAC
CATCATGCCATCTACTGGTCCCACTGGCTTCCTTAAAATTAATCTTTTGATAATGTAGAC
AAGGAATTGGGGTACAAAGTTTCTAAGTCACATGGCTCTGTGCCCTGTTTCAAATGATAC
GTTGCGTGTAGTGTGGAAGACTAGATAATAAAAGTCAAGCAGGTTAGTCCCACCCCCCCC
CTTTTTTTTTTAAGGGAAAAAAGAAGTTATTGCCTGGGATCAGCAGATGGCATAGTGATA
TATGTTGCTGAACTCCCATGTAGTTGACTGCAATTTGAGTCCCAGACCCAGAACTTAAAA
CTCACCGGATGTATGTGCATGCATGCCCAGAATCCTGAGAGGGAAATGGAAGAGAAGGGA
TTGTGGCATGGCCATTCCCCCTGGGGGTGAATTCTCTGTTTTTCTCTTTCCAGCACACAC
ACCCTGTAGCAGAAGAAATCTCTTAAAAAAAAATAAAAGTAAATTTTTGCCTTAGGGTGT
GAGTGCTGACCAGAGAGACAAACAGAGGGAAAGTGAGAAATCACCCCCTGAGGGGGGGTG
GCCATGCCACAATCCCTTCTCCGTTCCCCTCTCAGGATTTTGGGCACATCTCACATGGGC
CCAGTGTGAGTTTCAAGTCACCAGGTCCAGGACTCAAACCACAGTCTGCCGTGTGGGAAT
CTAGCGATATGTAACCAGTATGCCATCTGCTGGCTCCATTTAGTCCCCTTCTTTATCTTG
TGATTTAACTAGATCATTAAACATACATGTGCACTCTCCTATTCTCAAGCAGTTGCTCTG
AGTGTTGGGTGACAGATTATTTCTCCTTAATGTTCAGGTTCAGCAGACTGTGCAGGATCT
TTTTGGCAGAGCCCCAAGTAAAGCTGTCAATCCTGATGAGGCTGTAGCCATTGGTGCTGC
CATTCAGGGAGGTGTGTTGGCTGGTGATGTCACAGATGTATTGCTCCTGGATGTCACTCC
CCTGTCTTTGGGTATTGAGACTCTTGGAGGTGTCTTTACCAAACTTATCAACAGAAACAC
CACTATTCCAACCAAGAAAAGTCAGGTAAGTGCCATCCCTCTGTATCTTGTCACAGGGTA
TTCGTTTCTGTGAAGGATGTGATTGCAGCTACTTCTGTAAGCCTTTTTTAAAATTTGCTA
CAGGCATGTGAGCTGGCTGGAGATGGGGTGGCTATCCCTAGGGAAAATGGCCATATCACA
ATCCCTTCTCTGTTCTCTTGGGGTTTGGAGCATGCACGCACATGCATCTGTTGTCTTTTT
CAGGCCTCTAGGTTTGGGATTCACACCATGCTGTTGGCCATGTGGAATGCAGCAGCCACC
ATGCCAATTAGCTGGGCCCTATAAGCTTTTCCTAGAGAATTTCGCAATTTTTTTCTGCAG
TCTAGGCTAGTTGGCTGTGAGTGATGAGAATGTCACTGTTTGTTCTTTTTTCTGTTCTTG
GAAAGATCTTACAGTCATCTATCAATAGCAGTGGTGATTGTACAGCAGGCATCAATAGTC
TCTCCTTCACAAGATTAACAGTTAAAAGAAATCCTAATGTTTGGGGCTGAATTCCCTGTT
GTCTTCTGTTTTCAAAAGCAGCGAAAAGAACAGCCTGACCAAGATTAAGGGAATATACTT
GGCTGATAGGTGAATAGTGAGAGTACTGATGGCAAGCAGGGCTATTTGGATTTGGCTTGG
TCTTGGATTAAGAGTTATGTTTGGTTCAGCTGTTGTGGCACATTGATAGCACCACTACTT
GGGTGGGTACAGGTTGCATGGGAGGTCCAGGTTTGGTTCCCATGCCTGTCTGAACACACT
GGTCATGGTCACACACATCTGTAATCCTAATAGGGAGGAGAGGGCAGGAGGATCAAGTAC
AGCAAGACCCTGTGAAAAGTACTTAGATCTCTTTCCCTTCTCCTGCTGCTACTCTGAAAA
ACTATGACTATTGCTGTATTTGCACAGTGATATATTTGTCAACATACCACACTGAGGAGG
GTGTGGTGACTTCTGCTGAGTACATGTACTGTCCCTACATGTCTTTGATCTATTTCTCCA
GAATGTTTCACTATTTGAGCTCCTTATCTTGAAGCTTTCTGTACTAATGCTGCAACTTGG
TACGGTGCATTACTTAATCAATAGCTAGGGTGGGTCTTTTTGCTATACTAGTTCTCCTAT
TCCCTGAGAAGACGTTAGGACCCTTCTAACAGTGGTATGTGAATTCCTTCTTTGTCCTTC
TATATAAAAGTAACCAAGGAAGTTTTCTTACTCTTCTAGGTGTTTTCTACTGCTGCCGAT
GGACAGACTCAAGTGGAGATTAAAGTGTGTCAGGGTGAGAGAGAGATGGCTGGTGACAAC
AAACTTCTTGGACAGTTTACTTTGGTAGGTACTGTGAATCCTAAATATTTTGTTCCTGTC
TCTTTCCTGTAAAGATAGGCAATGTGTTCCAGTCCTTAAAATCATATAAACTTCTGACTT
AACATGGACTGATTCTAGGGTCAGATACCTATGGCCTCAGGGTGTGTGTGTGTGTTGTTG
TCGTTGTTCTTTGTTTTTTGTTTGTTTGTTTGATTGTTTTTGGTTTTGTTTTGTTTTGTT
TTTGCTAGAGGGTGCATGTGCACAACAGACAGGGCAAGGAAAAGAAAGTGTCCCCTTATG
GGAATGGTCAAGCACAGTCCCTCCTCCATCTCTTTCCTCCTTTTGGAATCTCAGGCACAC
AAGCACATGCTTCTGGCATGTTTTTTTGGTTTGTTTTTTAAGAATTATTTATTCATTTAT
TTTAATTTGACCAGCAAGAGACACATAGAGGGAAAGTGAGAAAGCAAGCCACCAGGTCCA
GGACTCGAACCGTGGTCAGCCATATGGGAGTATCCAGCACCTTAACTACCATGCCATTGC
TGGTTTGGCATGTTTCTGGCATGTTTCTTAAGCTGCTCAGTCTAGAACTTGAATCATGCA
GTTGAACATGTGGAATCCAGCAGCCTTAACCACTATACCACTTGTGTTTTTGTTTGTTAA
GTGCAGGTATCACTTGTGCCTATCAGGAACAAAGTCACTTGTTGGTTCACCAAGACTGTA
TAGACTTATTAATAGCCTGAACCTTTTAAAGAGAAAAGTTTATTCTAGACATCTGATCAT
TTATTTTAGATTGGAATTCCCCCAGCCCCTCGTGGAGTTCCTCAGATTGAAGTTACATTT
GACATTGATGCCAATGGGATTGTACATGTTTCTGCTAAGGATAAGGGCACAGGACGTGAG
CAGCAGAGTAAGTCCTTGTTTATTTGTTCGAGTGAGAAGAGGGACCTCTGTTGGGAAATG
GGCCCGTGTTATTTTGAGTGTCATTTGCTACAACCCTTGGGAGAATATAATGGATAAGCC
CTCTTCACTCTTTTCTCCTTAGTTACCAGATTTAATTTTAAAAGTTTAGTATTTATTCAA
AAAAGAAGAAAAAAAGGCAAGCCTCAGAGCCTCTGAATTAATGAAGATTTGATAGGCAGG
TATAGTTGGTGTCTGTATATTTCAGACCCTTGATTTCCTTTTGCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAGATGATATTGAAAATATGGTTAAAAATGCAGAGCA
ATGTATGCCGAAGAAGACCGGCGAAAGAAGGTGATTACATTACACTTTGGGGGGGGGGGA
AGAGTATGTATTTCATTTTGTTTGTTTTTAAGAATTATTTTATCGAACTTTATTCAGTTT
TAATTTGACCAGAGAAAGTGAGAAAGCCACCAGGTCTGGGGATCAAACCATGATCAGTCA
TTTGGGAGTCCAGCACTTTAACCACTATGCCACGTGCTGGCCCCATATTATGCTTTCTCG
CGTTAGTAAAGTCTAAGGTTTAACAGTGGGAATTGGGACATTTCATTGATCTTACATTTT
TATTTTGCCCCTAATATTTCACCTTTGCTTATAATTTATGTATATAGTGTCGGTCTTTTA
TCTTTTTTAGTCTTTTATTAGAACTCTTGTATTATAGAACCCAGCTCTATTTTTGTTCTA
TAATTTATGTAGCCAGATTGTATTGCTCATATGGACATTTTATTAACTTGTCAATCAGGA
AGTCTCCATTAAACTTTTAATTTTTCTAAGGAACGAGTTGAAGCAGTTAATATGGCTGAA
GGAATCATTCATGACACTGAAACCAAGATGGAAGAATTCAAGGACCAATTGCCTGCAGAT
GAGGTTAGAGGGTTTTTTATTTTCTTAAATAACTTGAAGTGGGAGGCATTCACCAGTGTC
CGTGAAGTTTATTTTTTCTTTTGATCTTGTTTGGGGCAGTTTGGGGGAGTTGGGTTTTTC
TTTTTGTTTATTTTTTTTTCCCCCTCAATATTACTGGTGCATGTAGTGGGACAAAAGAAC
TTGGAAAAGTAAGGTTTTATTTGTGGTTTTTTTAAGTGCAACAAGCTGAAAGAAGAGATT
TCCAAAATGAGGGAGCTCCTGGCTCGAAAAGACAGTGAAACAGGGGAAAACATAAGGCAG
GCGGCATCCTCCCTTCAGCAGGCATCACTGAAGCTCTTTGAAATGGCATACAAAAAGGTA
AAGGGGCTAAAAGATGTTTTGGTCCTAACTTGATCTTGATGTTACTACTTTAGATTACTG
TCACTGGTGGCTCCCTCCATAATTATTTATGGAATTGAGAGTGGGTGTTGGAATTAGAAA
TAACCTTTCCTGCCACCTTAACTTGGGGGATAGAGGCAGGAGTATAAAGAATCACCAAAA
CCACCAATAGTGTAGAAGGATTAGGGGTATGTGGCTCCTTTGTTTTGGAGTTCATCATGC
CCTAACATTAAATCATGGCTTTCAAATTTTTTCTTAACAGATGGCATCTGAGCGAGAAGG
CTCTGGAAGTTCTGGTACTGGGGAACAAAAGGAAGATCAAAAGGAAGAAAAACAGTAATA
GTATCTGTAAATTTGGACAACATAGTATGAAGCTTGGGAGTGAAGGAACTTCCTGAGCAA
AAATGGGCCGACTTCATCTTTTTACTGTGTTTTTGCAGTATTCTATATGTAATTTCCTTA
ATATGTAAATGTAGTTATCAGCAGCTAATGATCATTTAATGGGCAGTGATTCCAAACAGT
ACAAGGCTCACAATGATCTGTCCCCAGCCTGTCATTATTCAGTTGCATGTAAAACGAGGG
TATGGATGATTATTGATCATTAACATTGCTTTGCGCTGAAGTGGCCATATTTTCAAGGGG
TGAAACCTTCTCACACACAAAATAGCCATGAGACTGTATGGGGGATGTGATCCTTCTAGT
TAATTACCTACTGCTATACTGGCCTGTTAGACATGGGTTCCTTCCGCTGAGGCCTTGCAA
GGCAAACCAGCTGTGCCACGGTTGTAGATGGAAGCTGGATCAGTGGAAAATTAAGCTAGC
TATTTATGTTAGGTACAGTGTTTAAAACAAGGTAGTAAAGAGGCTCCTTAACTTTCCTAA
GGTGTACTTTTCTAGTTACCTTCTGGCCTATACCTTGCACATACATCCTGATTGTTCTTT
TTGATCCATTCTGGACTTTTTTAAAAAATAAATATGAAAAATATCTTAATCTCATTTTTG
AGAGTTGAGGCCCTATCCTGTGGTTTAACTTTAAGAATGACATATATGACTCCGACTTGT
GGGATCTTCCAAGGAACAAATAACTGGAATTTCTAACCCTGGTAAAAAAATATATATATA
GGGAAATAACAAGATTTGGAAGTAATAAGTAATGTTAGCCTAGGCACCTCTCACCGTATA
AGGGGTCCCCCACCAGAAACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCTATTTTTTCTCTTCCATCTTTGTGTATTGGGTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1081, 3173..3231, 3561..3648, 20329..20510, 21577..21701, 22857..22930, 23895..23998, 24957..25119, 25512..25604, 30051..30260, 32677..32904, 34119..34223, 34989..35106, 35453..35520, 35523..35549, 36030..36122, 36336..36476, 36760..36837
1001..1081, 3173..3231, 3561..3648, 20329..20510, 21577..21701, 22857..22930, 23895..23998, 24957..25119, 25512..25604, 30051..30260, 32677..32904, 34119..34223, 34989..35106, 35453..35520, 35523..35549, 36030..36122, 36336..36476, 36760..36834
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved