Tupaia_belangeri Locus PRDM4
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri PRDM4
Tupaia_belangeri
PRDM4
GeneScaffold_1326
SNORA17
33279..33413
45367
CGTTTAGCACCGTCCCTGGCAGGCAGCACGGGAAGGGCAAAGAACGAGGGCGAAGGCCA
TTTGTGCAGCACACACACCACCATCTACAACACGAAGCCGGCGAACAGGGCAACCTCTAG
CTGTAACATATGGCGACGAATATTTGGAACGTAATTGCTTCTGGGTAACGCCGCCAGACT
TGTAGGCTAAGTCCTTTATTTCTAATTTTGGGGGCTTATGTAGACCCAAGCTTCCCGAGT
GGGGAAATACGGTGAGCACCGAAACCTTGAGTCCGGGGCATTCAGAGGACACTGATGCAC
CCGAGCGTGCACAGCGGCCCTGGTCGCCTAGCAACTGTGAGTCGATCGCTCGGCGCTCGA
CTGGATTGATCCGGACCGAAATTCGGCGCTCGAGGGGAGCCTCCCTCGGGCCGCCCTCTC
CGGCGCGGGTGTCCGCGCTGGGCCTGGGGTATGCCCAACTTGTTTCTCAAGTGAGAATGG
AACTGCGTGGGGACCAATAAGTTAAAAAGAGGTATACAGAACGATCGGTTTCAATTTATT
CTAATAAACCCAATTTCATTACAAAAAAAGCCAACATTAAATATAAACAGAAAAAACAAA
GACAGAGAGAAACACAATCGGTAATTTCATCCGCTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTCCCTCGTCTCCCCAGGTTGGCTGCACCCCTCCTGAAGCTTCTCG
CGAAAGGCTCCGGGTGTCCCCCGCCATGCCCGTTCGTGGCGGAGTGCGCGGCCACCGGCC
CTCGGGAGAAGTCGGGTGGCCCCGAGTGGCCCTGGGGACGAGTGGCCGCGTTTGTGCAGT
GGTATTAAGCAGGATGCGGTAGCACGTGACCCTGGAGCGCAAACCCTGATGCCGTTTCTC
CGCCACGCGGGCGCCCTTTTCTGACACTCGGCCGCGAGCAGATGCATCACAGGTGAGTCG
GCGGAGGGGGTGGGTTAGCGCTGGTGACACCTGGAAAACCTCTGGCACGGGAGTGTCTGG
AGTTGGCGTCTTTGTGGTGCCGTTGGAAAGCTGACGGATGAGATTTGCAAATGGATTTGT
GTCCCAAGGGAACGAGAAATCCAGAAACTAATTGGCCCCAGATGGGAGTAGTTCCAAAGA
GCCACACATCTCTCGTTGTCTGATGGACACCTTGAACTCCATGTTTGGAGTTACTTGCGC
GCGGAGTAATACTTTGAGCTTGTGATCATGATCATCTGGAGGTAGGGCATGGTCCCCCTG
CAATCCCGTCTTCCATCTCTTCCCTCCTTTAAATCCAGGTCCGGGAGTCCACTCATGTTT
GGCCATTTGGGATCCTGCTGCCTGAACCACTATGCCGTGGGCTGGCTCTTTTCCTAAGTA
TTTTAAGAAAAAGACATGAGATCATTTGGCCAGTGGCTACCTAGGTTAGTTAGAAACACA
TAGAAACTGTAGAAAGAATGTAGGAAGGTGTTTCAGCCACAAAAAAGAGAGATTAGAATC
TCCATTTGGCTCTTTTCCGAAGGGCGCTTCTTATCATCCCTTAGGAGAAGGGTGGTTAGC
CTAGAATTGTACTTCAGAATGAGAAAGTCTTAGAGAGGCTTTTTGGTGTTCCTCATCTGC
TTTCTCTCTGTGGGGTAGTAGTTACCTTTGGTTTATGGTTGCTGAGGTCATCACATTTTA
GTGACTCACAACAAAGCAGAAATCTGCTGAGCCTCTCCCATTAAACTCTGGTTTGAACTG
GTTTGAGAAGGCCTAGGAGTCAACCCAGAAACACCATTTTGATTTTTATCTCAAGATTAG
TTACAGAGATTAATTTCAGGAACTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCATGCCTGGTGTGATTTCAA
GCCACCAGGGTCTGAGACGAACCGCAGAGTTGGCCATATAGGGTCCGGTGCCTTGACCGC
CACGCCACCTGCTGGCCTGCTCTATTTCTTTTTAATTTCAATTCTTTATATTTTTAATTG
CCAGAGAGAGGCAGAGATGGAGTGGAGGGGAGACAGCGCCCCCATGGGGCATGGTCACGC
CATAATGCCTTCCCCTTCGTTTCTCCATCCCGCCGGAATTTGAGGCACTAGGCTGTGTGG
CCAGCCCAAGACTTTTACCTTTTAAATCTGTTTCTCTTTCTGTGTCCTGATTTCAGTTGA
TGGGAATTCACTCCAGCTTTAACGTCTCCATCCTCAGAGGGGCCAAGCGTTATCAGTCCT
GCTCCCCCGTCGTCTCTCAGTTCACCCCTTCCTTCCACATTCCCACCATCTTGTTCAGGT
GCCCGCTTCACTTCCTCCCTCTCAATTATTGCAATACCCGACTGGTCTGCTGCTTCCTGC
CCCCAGAGCGCTGACGGTTCATCCCCTCTCCAAACCCCGCCCCCCATAATGTGGGGTTTT
GGGCAGCAGGTCTCCACAGAGTAAAAAAAGTCCAAGCTTTTTTCATCTGTCAGTGTTTTC
TAGAACATTCTCTCAGCCATCATTTCTAGTCTCCTGTTAGTCAGCCTCTATTCTCCAAAC
ACAGTACCTGCCTTCTAGGTGAATTTGTTCTTGTATCCTTTGCCTGTAATTCCTTTTTTT
TAGAATTATTTATTTATTTATTATTATTCTAATTTGCTATAAGGCATATGTGCTCACCAG
AGAGAGAGAGAGAGAGAAAGAAAAAGTGAGAAAGCAAGCCACCAGGTCTGGGATTCAAAC
CTTACTTGGCCCTGTGGGAGTCCAGCACCTTAAGCACCACGCCACCCACTGCCCCTGCCC
ACTGCCTCTAATTCTCTTTCCATTTTCACCTGCCAAAGGCACTCCCAGAAGCCTTTCTTC
CTTGTGTTCTGCTTGCTGAAAGCTAGAATGAGCCCCTCTTTTCTTTATACCCTCACGGCA
TTTTTCATTTTGGAACTCGGCTACAGCGTTTGTACTTTCCCCCTCATATTCAGGTGAAAT
GGGTCTATTTTCTCACCAGTTTGTAAGATTCTTCAAATTCCATTCAACAACAACAACAAA
AAATGATAAAACTTGCATTAAAAAAAATTGGCATAGTAACAGCAACTCGGGCTCAAGAAA
ATAATAGGCTGCAGACAGATCCCCAGGGCTGGGATCGTTCTAGTGGGAAAGAGAATCACA
AGAACCAGAAAGCTTGCTGTATTGCGTGGCAAGGCAGTGGAGCATGCCCTCCTATGATTT
CTTTGGCCCCCGGCTGAGAACTTCGCGCTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGAAC
TGCCCAGTCGGCCACATGGGATTCAGCCACCTTCACTCTGCAACCACCTGCCGGCCCACT
TTTCTCTTTTTCTCACCAGTATCTCTCTTGGAGAAGTTCATTTACTATTAGCACTTAGAG
GAATATGACTCAGATCTACAGCTATCCTGACTTCCCTCCTAACTTCAACATTTCACTTCC
TTTTTCATAATGCTGTATATTTTTTAATTTTAATATTTTAAAAAATTTATTTAACGGGGA
CCAGCAGTTGGCGTAATGGCTGTGTTGCTGGTCTCCTATGTAGTCGACCACAGCTCGAGC
CAGACCTGGTGGCTTAAACTCATGCCCGGCACATGTGCCCAAGATCCCAAGAGGAGAATG
GAAGAGAAGGGATTGCAGTGTGGCCATCCCCTCTGGGGAATGATTTCTCATTTTCTGTCT
CTCCGTCTCTCTCTGTCTTTCTGACGAGCACATGTGCCCTATAGCAAAAGAAAAAAAAAA
TTTTAATTATTTTATTTAACTTTATTTATTTTGATTTGACCAGAAAGGGACAAAGCAAGA
AAGAGAGAGAGGAGAAGTGAGAAAGCAAGCCATCAGGTCTGGGACCCGAACCACAGTCAT
CCATGTGAGAGTCCAGTGCCCTTAACCACCATGCCACCTGCTGGCCCTGGAGGCATATAG
ACTAGTACCAGATGAGGCTGATGGACATATTTCTTCTTGGACACACCCTTGGTATGGCTA
TGGCCACCAGTGTTCTTGGTAAGCTGACCCCAGACCTGAAGGCCTCAGAAGGGGTCTGCA
TATTTCTGTCATCCCAGGTCTTCATGGAGCTTGTTCTCCAGACTGTTGGCCAGGACCCGG
TTGTATTTTCCATCTTTCTGTCTGTGCAAGAACTAGCCTGGGACCTTGACTGGCATGGAT
AATGCATAGGAGCTCACACCTTCCAGCTCATCCTCAGCGAGTACTGCCCTCTGGGTGGGG
CCAGTGTCTGCTTTCCTCAACATCATGTGAACGTATCTCTGCTCCACACCCTTAATGGCA
GTGCCACAAAGGCTGTTTCCTGCACCCATTGATGCTGGTGCTGGGGACCAGATAGCATAG
TGGTTACATCACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTATTTAACTTTA
TTTATCCATTTATTTACTTATTTTAATCTGACCAGAATGGGACAGAGTAAGAGAGAGCGA
GAAAGTGAGAAAGCAAGCCACCAGGTCTGGGATTCCAACCGTGGTTGGCCATGTGGGAGT
CCAGCGCCCTTAACCACCACGCCACCTGCCGACCCCTAAAATAATTCTTATTAAAAAAAG
TTGGTAATTTACACTCCACTGGTTGTGTAGCAGATACCATTTTACCAGATCCCAGCAAGC
ATGATTGCTAAACTTTGTTTTAGTTAAGCTAGTAATATGTCTTGATTAAAATTTAATGTG
TTATAATTCAGTAAGAAAAACTTCATCATATTTAGTTGTCTTTTTTAACATAGATGACCT
GATTCTAAATAATTTTATCTTTAATTCTTGTACAGCAAATTTTAGCATCATATGACTCAG
GAATTGGAACCGTTTTTTTTTTTTTTTAAAGAGATTTTTGCTATAGGGAGCATGGACTTG
CCCCAGAGACAGAGACAGAAAGCCAGAAATCACCCCTTGGGGGCATGGCCATGCCACAAT
CCCTTCCCCATTCTCCTCTTGGGATCTTGGGCATGCACACACGTGTGCCTGGTATGAGGT
TGAAGCCGCCTGGTTTGAGACTTGAACTGTAATCAACTGTGTGGGAGTCCAGCATTCTAA
CCATTATGCCATCTGCTGGTCCTGCAACCATAAATATTAGAGACAGTTTTTAAATAACTA
ATTTTTTTTTTTTGAGAGGTTTTTGCTATAGGGCGTGTGCTCTCGCCAGACAGACAGAGA
GAGACAGAGAGACAGAAAGCAGGAAATCACCCCCCAGGGGGTATGGCCACGCCGCAATCC
CTTCTCCTCCATTCTCCTCTCGGGATCTTGGGCACGCATGCACACGCGCCCGGCGTGAGT
TTAAGCCACCGGGTCCGGGACTCGAACTGCGGTCGACTACGTGGGAGTCCAGCGACATAG
CCATTACACTAACTGCTGGTCCCTTAAATAACTAATTTTCAGAGAAATCGTTTTTTAAGA
TTTCTGAGTTACACAGAAAAAAATAATTTATATCTGTTGCTTCATAAAAGTGTATGGGTT
GATTACATTAAGGGAGATTATTTTAACTTCATTATATTTGTAAGGAAAACAGCTTTTAGC
ATTTTTAATTCTTTATATTTAACACTGCACTAAAAAGTCTCTGATATTTCATCTTTCTCT
TTCTCTTAGGCATTTTATCTTATTTAGCTGACAGACCACCTCCTCAGTACATCCACCCCA
ACTCTATAAATGTTGATGGTAATACAGCATTATCTATCGCCAATAACCCTTCAGCACTAG
ATCCCTACCAGTCCAATGGAAATGTTGGATTAGAACCAGGCATTGTTTCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGAACCAGCATTGTTTCAATAGACTCTCGGTCTGTGAACACACATGGTGCCCAA
AGTCTTCATCCCAGTGATGGCCATGAAGTGGCTTTGGACCCAGCAATCACTATGGAGAAC
GTTTCTAGGGTCACCAGCCCAATCTCTACTGATGGAATGGCAGAGGAACTTACAATGGAT
GGTGTGGCAGGTGATCATTCACAAATCGCAAATGGCTCCAGAAGTCATGAACCTTTGTCC
GTGGATTCTGTGAGCAACAACCTTGCAGCAGACACTGTAGGACATGGTGGTGTGATACCC
ATTCATGGGAATGGCCTGGAGCTCCCTGTGGTCATGGAGACAGACCACATCACTAGTCGG
GTCAACGGGATGTCGGACAGTGCCCTCAATGACTCCATCCACACTGTGGCCATGAGCACC
AACTCTGTAAGCGTGGCACTCTCTACCTCACACAACCTCGCTTCCTTAGAGTCTGTTTCC
CTGCATGAAGTTGGTCTCAGTCTAGAACCAGTGGCTGTCTCCTCTATCACTCAGGAGGTT
GCTATGGGAACAGGCCATGTAGATGTATCTTCAGACAGTCTTTCTTTTGTACCACCTTCA
CTGCAAATGGACGACTCCAATTCAAACAAGGAAAACATGGCATCCTTGTTTACAATTAGT
GAGTGTGCTTTAGCCTTTCTCTCGTGGAAATATTGGTAAAAAGGGTCATCGTGCCTAATA
AGCGTAGCCACAGAGGGGGGTGTAGAAAGGTAACTAGACCCTGCCCCTAGAGGCGTTGCA
GTTGTGGCTGCTGTGTCACAGCTGTGTCAGTTGTGGGCAGAGAGTACAGAGGGCTATGTC
TACGCTCAAGTGTTCTGACCCCATGAACATTTGAATGATTAGTAACCTGACACTTAAAAA
AGTAACTAGATTGGAATTTTTCTTTTTAAAATTTGTCTTTTTATTGTCCTTGATATCAGT
ATGGTGTCTTTTGTGTAAGTAAGCTAAATGATATGTATTTTGTTGGTCCTTACAGCATCC
TCCTGAAAAAGGAGATACAAAGTAGTTACTTCTGTAATTTATGGATAAAACTTATAGCTC
AATAATTATTTATTATAGTTACTTTTTAAAGAATTATTAAATTTTATTATTATTATTATT
TTTTAATTTGACCAGAGAGGGATAGAGTGAGTGAGAGAGAGAGAAAGTAAGAAAGCAAAC
CACTAGATCCAGGACTCAAAACTTGAGTTGGCCATGTGGAATTTCAGTGCTCTTAACCAC
CATGCCACTTGCCAGCCCCAATTATAATTATTTTTAATTTGCTATAGGTATGTGTGCTCA
CCAGAGAGAGACAGAGGGAGAAACACCAACCGACCAAGTCTGGGACTTGAACCATGGTCA
GCCACATGGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATTTTAAGAATCC
TATGAATTGGGAAATTTGACTCAGTCACTAATAATTTCATGAATACTATCTTAACAGAGA
GAAAAGAAAGTGTAAAGATTAGACCAAAAGAAGATTTATAGAGGGCACTCACAAGCTTGT
GAAAGTGATAAGAACAGAGGACAATATATGAATGCACTGCTCTGAAAATGCAAAAAGAAA
GTCCCTATGGGCAATAAGGTATTCAGAGAGCTAAGCAATACATCTGCAAGAATATGTTTC
TAGCTGCTCTCCAAAAGGGCAACTTGTAGATTTTCCTTTTCCTTAGAATGTGTCATTGTG
GGGCCAGCAATTGGTGTCATGGTTAAGGCACTGCACTCCCACATGGCTAACTGTGGTTCA
AATCCTGGACCTGGTGGCTTGAAAATCACAGTGGTCGTGTGTGTGTATGCCTAAAATCCC
AGAAGAAGGAGGGATTGTAGCATGGCCATCCCCCCTGGGGGATGATTTTCACCTTTCCTC
TCACTGTCTCTCTCGCTCTTTTTCTGGTGAGTGCATATGCCCTATGTCAGAAACCTTAAA
AAAAGAAAATGTGTCAGGCACTGGACACTCCCACATGACTGACCACTGTTCGAGTTCTGG
ACCTGGTGGCTTGCTTTCTCACTTTGTGTGTGTGTTTGTGTGTGTGTATCTGGTCAAATT
AAAATAAATGAATGACCAAATAAAAAAAAGGGGGACCAGCAGTTAGCGTAATGGCTATGT
CGCTGGACTCCCATGTAGTCGACCGTGGTTCAAGTCCTGGACCCAGTGGCTTAAACTCAC
GCCGGGCGTGTGTGTGTGCGTGCATGCCCAAGATCCCGAGAGGAGAAGTGAAGCAAAAGA
GTACAATAATATAACTGTTTTGGACTCCATTATCTTGTAATGTCTCTGTGATTAATAGCA
TTTTAATTCAATTTCCTCTTAAAATTCAGGATTGGAATCTTTTGGCCTGGGGGCACCATA
TCTGAAATGTTACATATCAGCTACTTAATGTAGGTGCCGTGCTTGGCTGCTGAGGTAGTA
CAGTGCTGTATTTTGATCCATCTTTCTCGTGCACTGAGTGGGCAACTTTTCCTTTCGTCC
CAAAAGGAAAACTCATCTTATTGAAGTCTGTAGGGAGGTAGAGGTGTATGTCTGTATTGT
TGTAAGAAAGTGGTTCTTTGAGCAGAGTATTTCTACTGGAACTTTGTTTCTTTCTGGTTG
TTTTAGTAGTTAACACTGAAATAAAAATCCAGGTGGCAGTCTCACCTGGCTGAACAGAAT
AAGCCCATTTGTGCCTCTCCTATTTGCTGTCCACAGGGTGCACTCTCTGTGACCGAGCCT
ATCCCTCTGACTGCCCTGATCATGGCCCGGTGACCTTTGTTCCTGACACTCCGATAGAGA
GCAGAGCGAGGCTCTCTCTGCCAAAGCAGCTTGTTCTCCGCCAGTCAATTGTGGGAGCAG
AAGTTGGTAAGAGCCTTGGAACCATGAAACTCCGTTAAGTCTCTTCTTCCTTTGTAGAGT
GGAGTTGTGAAAGTGTGAGTGTATGATTTAGTGATTATTTGGTGACCAAAAGTCAGTCTA
TGACCCAAGATTCATGCTTTTAGGAAATATTTGTCATTTGGTGGTGGTAACAATAAATCA
GAGAGAAAAATGTATTGGCAGGACGGCTTTCCGTTTCTTAGAATCAGAATTGAGTAGAGG
AAAGAAGCCTGGCCTGAGTCTTTGAAGACTTGTCTTTTACACTTAGCTGTCTCATCCCCT
AACAATTATCCTAACAGTATTCTCTTTAAAACTTAGCATCTTGGGACCAGCAGATGGCGT
AATGGTTATGTCACTGGACTCCCATGTAGTCGACCGCAGTTCACATCCCGGACCCGGTGG
CTTAAAACATGCTTGGGGGACCAGCAGTTAGCGTAATGGCTATGTCGCTGGACTCCCATG
TAGTCGACTGTGGTTCGAGTCCCACACCTGGTGGCTTAAAACTCACACCGGGCGCGTGTG
CGTGCGTGCCCAAGATCCCAAGAGGAGAATGGAGGAGAAGGGATTGCGGCATGGCCATCC
CCCCTGGGGGGTGATTTCTCGCTTTCTCTCTCTCTTTCTCTGTCTGTCTGTCTGGCGAGC
ACACACGCCCTATAACAAAATAAACCTCTCAAAAAAAAAAAAAAAAAAGAAAAAACACAT
GCTAGGTGTGTGTGTGCATGCCCAAGATTCCGAGAGGAGAATGATGAAGGAGTCATGGCG
TGGTCCTCCTCCCCCTGGAGTCATGAGACCTTGACACCCTGAAGAAGGAAGGAAGTAATT
TGCCCAGAGTTGCATAAGGCTAGAAATGTCAGTGCTGGGATTCCAAACGCCCACGCAATC
ATCCCAAGTGATTTCTCGCTTTCTGTTCCTGTCTCCAGAAAGTGCACATGCCCTATGACA
AAAATTCTCTCTTAAAAAAAAAAAAAAACTTANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGACGTGAGGGAAGTGGGTCTCGTGTAATTGTAAAGTAGGTTGC
AGTTGTCATTGGGGACTTCAATTATGGTGTTCAAAGTGGAGCTCAGAGTGCTAGGTCCAG
TGGGAAAAATGAGAAGGGCCGATTCTCTGCCTTTAATGGACATTCGGTCGTTTAGTGCCT
ATGATGCCTGTAACTGATGAAGACAGATAGATGAGGAAACCTTTTCCTTTTCCAGCATAA
AAGTGAGTAAGGACAAAGTCATTCTGTACACTTAGTACTAACTGCAGGTGTCTGAGGGCT
CTTGAGTCTTGCTGCGAACAGTGGGACTACTGAAATGACAGCCATGTGGGAAGGGCTGCC
ATTTTCACCCTGACCAGGAAAGCGTGTACCTACTGCACTTAAGCGAATACACGGTCGCCG
GCCGAGATCTGTTGTAGTACTTTGTCACTGTCAGTTCATTTGACAAGGTGTTTTCCATTG
CAGATATACCACAATGGTGTCCTAGAATTCTGCATCATTGCAACTGATGAAAATGAATGT
AATTGGATGATGTTTGTGCGCAAAGCCAGGTAACAGTAGCCTTGAGTGGGAGAAATAAGT
ATCATTCAGCTGTTTTTCAGTAGGGAGCTTTGCACAAGATTGGGAAGAGCCGAAAAATCC
ACATTGATACCTGGATATACTTAAAGCCTAAGACTTCTTTCCAGTAGTGGTTGACTAATG
GCGATTATAAATCAAAACACACAAAGCTGTCCTTTTTATTTTTATTTATTTATTTAACAA
CATATTTTTAGAGGTTTTTGCCATAGGGCATGTGCATTCACCAGAGAGAGACAGAGGGAA
AATGAAAAATCACCTCCCCCAGGGGGGATAGTCACATCACAGTCCCTTCTCCTTCATTTT
TCTCCTGGGATCTTCGGGTAAACATGCACACATGCCCACTGGGGTCCAGGACTCAAACCA
TACTCAGCTGTATGGTAGTTCAACAACTAACCACCACGCTATCTGCCCACCCCTTTTTAA
TGACGAGAACAATATAGTCACTATTGAATTTGCAAGTGGTTATCTTCTCTTTATATTCGC
TGTTAGCCTCCTCAGGCTGCTACTGGAGTTAATTCTTGTTCAACTAGCTACCTGTATGTC
TTTTTTAAATTTTTTTAAGAGATTTTTGCTTATAGAGCACATGCACGCATCAGAGAGATG
GAGAGAGACAGAAGGCAAAAAATCACCTCCTTGGGGGATGGCAGTGCCACAGTCACTTCT
CCATTCTCTGAGATTTTGGGCACACATGTGTCCAGTGTGAGTTTTAAGCTGCTGAGTTTG
AGATTCAAACCATGGTCGATTGTGTGGGAGTACAGTGATGTAACAATTATGTTATCTTGG
TCCCTGTTATATTGTTTTTTAAGACTACATGTTATTACTCTTTGCCTCAAGTAACAGACT
CTAGTGTTTCCTTTTTTTTTTTTTTTTTTTGGAGAGGTTTTTGCTATAGGGCGTGTGTGC
CCGCCAGAGAGACAGAGAGATAGAAAGCGAGAAATCACCCCCTAGGGGGGGATGGCCATG
CCACAATCCCTTGTCCTCCATTCTCTCGGGATCTTGGGCACACATGCACACGTGCCCAGT
GTGAGTTTAAGCCACTGGGTCCAGGACTCGAACCGCGGTTGACTGCATGGGAGTCCAGCA
ACATAGCCATTATGCTAACTGCTGGTCCCGTAGACTCTAGTGTTTCTGACTGTAGTGGTT
GTTAATCAACCGATAAACTAGAGTAAGAATTGTGTTTCTCTTCAAGTCTCTCCTAATAGA
TGGATAATTATTCAGAGAAATTAGTTCTCAGTTTTCATGTATGGTTTTGCTATCGAGTAT
ATGATATGTTTAGTATAAAGTTCAAAATTAATAAACTTGGTCTGTTATATGTGGTGATTT
AGGAACCGGGAAGAGCAGAATTTGGTGGCTTATCCCCACGATGGAAAAATATATTTCTGC
ACCTCACAAGATATCCCTCCTGAAAACGAACTGCTTTTTTATTACAGCCGGGATTATGCT
CAGCAGATTGGTAAGTTAATGTAAGATTTGTTCATTGTGCCTCTAGCACAGTCAAAATGT
CAAGGACCAAGAGTAAAGTTGTGGTGATGATTTACATGTCAGCTGAGCAAGCCACATGCC
TTTGTAAATATGGAACAGACTAGTACCCCAGTGTTTGAGGTCTTAAAATCTGCAAAGTTC
ATGACAACCTGAATGTTACCAAACAGTATTCATAAGAAATGATCTTTGATGCTATACCTT
TGATTTGGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGGGGCA
GGTCTGGGCCATACCAGTTTTCTTTAAGGTCAGCCAAACCACGGACCTGAGCCCTGCGGT
CAGCCATGTGGCCTCAGCACTGCAGCTCAGTATGCTGCTGACTTCACCAAATGCTGGGCC
TTTAAGGTTACTTTTGTGAGCTAGCACTATTCAGATTTAAGTTCATAAAACAGAGTCCCT
GATTTGATTTAACCTGCATAGGCTTTCTCTGCACTGTATCATGACAAGTGATGTTTAAGA
GTTATGTGTTATAGAATGTAAATATTTTGCTTAGGAAAGAAGCCTTGTAATCTTGTTTTA
CTAAGTGCTTTTATGCACCTGGTACACTATTTTAGATTCTGGAAATAGAGCATTGAACAA
GATGGTTTTACAGGAAGGGGGCAAGTTGGCTACTAATATTAAGAGCAAGTTTTAAGACAA
AGTATCAGGAGACATTGAGTAATTTCTTTTTAAAGGTGTTCCTGAACACCCAGATGTGCA
CCTCTGTAACTGTGGCAAGGAGTGCAGTTCCTATTCAGAGTTCAAAGCCCATCTGACCAG
CCACATCCATAACCATCTTCCTAGCCAGGGCCACAGCAGCAGCCACGGACCAAACCACAG
CAAAGAAAGGAAGTGGAAGTGCTCGATGTGCCCCCAGGCTTTTATCTCTCCTTCCAAACT
TCATGTCCACTTCATGGGTCACATGGGTATGAAGCCCCACAAGTGTGACTTCTGTAGCAA
AGCCTTTAGTGATCCCAGCAACCTCCGGACCCACCTCAAGATACACACAGGTAAGTAATT
TTGGATTGTCAGAATGTTTTCTTCTAATGAAAAATTTTCCCCTTGGCGAGCCGGCTCGGA
CGTCGCTCGTTTGCCCCCTGGACTCTCTTCCTTTCCCCCATCTGGCTGATGCACTCGCCC
TGTTATGAGCCGTGGGGAAGGGGTCGGGGTGCACGGGAGCGCGCCTCAACCGCGGCGTTG
CATCGTTTCATGGAGCCCACGCGTTCAGGAGGAGCACGTGGCATCCATACTTGGCCTCTG
GTGTGGCTGTCTGAAAGCGTCATCAAGGTGTTCAACGACATGAAGGTGCGCAAGTCATCA
ACACCAGAGGTGGTGAAGAAGTGCAAGGAGGCAGTACTCTTCTGCCTGAGTGAGGACAAG
AACATCATCCTGGAGGAAGCCAAGGAGATCCTGGCAGGTGATGTGGGCCAGACTGTCGAC
AACCTCTATGCCACCTTCATCAAGATGCTGCCAGATATGGGACCAGCAGTTAGCGTAATG
GCTATGTCGCTGGACTCCCATGTAGCCGACCGCGGTTTGAATCCCGGACCCAGTGGCTTA
AACTCATACTGGGTGCGTGTGTGTGCGTGCCCAGGATTCCAAGAGGAGAATGAGAAGGGA
TTGCGGTGTGGCCATCCCCCCTGGGGGTGATTTCTCGCATACTGTCTGTCTCTATCTGAT
GGCGAGCGGCAAAACCTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAACGATGCTGCAGA
TAAAGACTGCGCTATGTCGCTATGATGTGACCTGTGAGACCAAAGAGAGCAAAGGGGAAG
ACCTGTGTCATCTCTGGGCCCCCGAATGTGCTCCCCTAAGAGCAGAATGATCTATGCCAG
CTCCAGGGATACCATCAAGAAGAAACTGACAGGGATCAAGCATGAATTACAGGCAAACTG
CCAAGAGGAGGTCAAGGACCACCACAACCTGGCAGAGAAGCTGGGAGGCAATGCTGTCAT
CTCCCTGGAGGGCAAACCTTTGTGTGCCCCCTCCAGTCCCCTGCCTGGAGCATCTGGCAG
CCCCATACCTGCCCTTGGGGGTTGCAGCAGCCCCCTTCCTGCCAGACCAGAGGGGCTGGT
GGGCCCAACAAGGGAAGGGCAATTCCTTCACCCCAGTTGCCAAACAGCCCCCCTCCTATC
CCCTGGATCTTTCTCCTCCCTTCATCCCTGACAGTTCTGGCTTTCCCAAACCGCTTTTGA
TCTTCCAATTCCTTCTTGGGTTGAAGCAGAGCAAGTTCCCCCCCAGGCAGGGGGGAGCCT
GTATTTTTTTTTAACAACATCCTTACTCTCCATCTGTTCCTCCCCTCCCCATGCTGCCAG
CTTCTAACCACAATAGTGACTATGTGCTTGTCTGTTTAGTTCTGTATATAAATGGAATGT
TGTAGAGATGATCCCTCCCCGTGCCGGCTGGTTCCCTTCCCCTTTCTCCTTGTCATGGCC
ACTCATGGAAGCAGGACCTTCAGTTTAAAAAGATAATTGACAAATGAAAAGACTCATTAA
TGGGGGAAAAAATTTCCCCTTTAATCATTATAATGCATGTGTGAGGCAGAGGGAGGGGGA
GAGGGAGATGAGTACCCGCCTTGGGATCTGGTTTTGCTGCGATCCCCTTCCTTCAGTCTT
CCGGCCCTTTGGATCTTTGGCACTCTGTGTGTTGACATGGTTCAGACCAACACAACTGGG
GCTTCGAACCATGATCCCCTTAGGGAATTCAACTTCTCTTGAGCAGTGTAGTACTATTGT
GCCAGGGAACCAGCTCCCAAATGGGATTTTTGCAACAATTAGAAATTATAGTAGTGAAGG
ATTCTATTTCATCCCTGCTTTTATGAGGTCATATATGTTAACTAGAAAAAGACAGTAAAT
GAGAAAATATAGCTTGTAGAAATACATCAGTAAGGACCAGTAGCTGGCGTAATGGTTATG
TTGCTGGACTCCTACGTAATCAACCTTGGTTGGAGGCCTGGACCTGGCGGCTTAAAACTG
GCTGGGTTCGTGTGTGCTCAAGATCCTGAGAGGAGAGTGGAGGAAGAGGGATTATGGCAT
GGCCACCCCATGATTTCTTGCTTTCTGTCTCTGTCTCCCCAGTGAGCTCACACGCCCTGT
AGCAATAAAAACTCTTTAAAAAAAAAATGTGTCAATAGACAGGTAATAGAATTGGTGAGT
TCTAGGAGCAGCAGATGGCATAATGGTTATATTGCTAAACTCCCACGTGGCCAACTGTCG
TTCAAGTCTCAGGCCTGGAGGCTTGAAACTCATGTCAGGTTCATGTGTGTATGTGCCCAA
AATCTCAAGAGGAAAATGGAGGACAAAGGATTACAATATGGCCATTATCCCTGCAGGGAG
TGATTTCTCGCTTTCTGTATCTCTGTTTCTCCAGGGAGTGCACGTACCCTGTAGCAAAAT
CTCTCTAAAAAAAAAAAAAAATTGATGAGTTCTTTTGTTTAATAATTGTATTGGGGTACT
GTTACTAAAGTGATTATTTTTCATTTGTTTGCTATAGATATTAAAATATTTAATATATTT
GTGTGTAAGAGGTTCTAGAGGGAGGTTAAATTTTTATTCCCTTTACTACCTTTAATAAAT
TACAAATTTAGCAGCTCTGAATAATTCTAGGTAGAAGGCCTAGAGTGCCAGGTGACAGTT
CGGTTACAGTCAGTTCCTCATTCCTGCCTCTGCTAGGTGTTTGCCCGTTTTGATTGCCAG
CAGTTGTTTTATTTATTGTGATAATTTGGGTTCATTTGCAGGTCAGAAGAACTACAGGTG
TACTTTGTGTGACAAGTCTTTCACCCAGAAGGCTCACCTGGAATCGCATATGGTCATCCA
CACAGGGGAGAAGAATCTGAAGTGTGATTACTGTGACAAGTTGTTCATGCGGAGACAGGA
CCTCAAACAGCATGTGCTCATTCACACACAGTAAGTTACCCTACAGCCAAGAGATCTTCC
CTCCGGGGATCCCTAGTACAGCTATAGCCAAGCCTGCCAGGTCAAGGGCTTGGAAGTGCT
GGCTCATCTGTGACCTGCTTCATGCTGTGGTAGATGTCGCCTGTGTTCCATGTAGCCAAG
CAAGGATTGGATTTTTCTCTTTGAAAATTATCTCACTTGTTTATTACTTTAATCATGCAC
TTCATATACTTATTTGATGACCAGGATTGTACTAGGTTGTAGAAATGTGGAGGTGAAAGG
CACTCTCCCTGTCTTTAAAGAGCTCAAAGCGCCCAGGAAGAGAAACCAGCATGTTAACCT
TTCTGATAGTGGCACAGGTGTTAGCATATGCACTTGGTTTTGAGAGATCAGAGGAGGAAA
AGTTTCCTGGTAGTTTGAGCATTTCCCCCCCAGTGTTGCTCTGGAGTGCATATATTCTCC
AGAGAAAGGTTGGTCATCCACATACGAAGGAGGGATGGCCATGCTACAGTCCCTTCTCCT
CCTGTCTCCTCTCAGGGTTTTGGGTTCACATGCCCAGTATCATTCTCAAGCTGTTAAGCC
CTGGTCTAGGGCTTAACTATGCAGTCAGCCATGCACACGTGCCTCGCGTGACTCTCAAGC
TGTGAGGGCCAGGACTTGAATGATACAGTTGACCATGTGAGATCTAGCATCTTAACTGCC
ATGCCACTCGCTGGCCCAGTTTGAGCTAAGTCTTCAGGAAGGTAGAATTAATGTGAGTGG
TATTCTAGATGGGATTTGGTTCTTGCACACACGTGTGCCCAGAGTGATTTTAAGCCACTA
GGTCCAAGACTCAAACCACAGAGTCAGCTATGTGGAATCTGCCTTAATCTCTATGCTACC
TGCTCGTCCTGATTAACTTTTTTTTTCTTTAATTTTATTCATTCGTTTATTTTTTAATTT
GACCAGTGAGAGAGACACAGAGAGAGAGGAAGTGAGAAAGCAAGCCACCAGGTCTGGGAC
TCGAACTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1011, 1987..2120, 2221..2406, 30849..30999, 32534..33177, 36216..36365, 38028..38146, 38763..38848, 40202..40329, 41135..41449, 44201..44367
1001..1011, 1987..2120, 2221..2406, 30849..30999, 32534..33177, 36216..36365, 38028..38146, 38763..38848, 40202..40329, 41135..41449, 44201..44367
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved