Tupaia_belangeri Locus RPS3
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri RPS3
Tupaia_belangeri
RPS3
GeneScaffold_4425
SNORD15, SNORD15
1738..1881, 5269..5414
6703
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGTCAGAGAA
AGCAGGATCCCCTCCCAAGGGGAGATGGTCACACTGCAATCCCTTCTCATTTTCTCTTGG
GAGTTTGAGCATACATCTACACACACCCAATATGAGTTTTAAGCAGCGGGTCTCGGACTC
CAACCGCTGTCGACTACGTGGGAGTCCAGCGACATAACGGTTACACCATCTGCTTGAGCT
CAACTACTTTTTTTTTTAATTGAAAAGAACGGTGAGCACATGAGCCACTACTCTTGTGAC
TTCTGTTACAAATCCTAACGAAATCTGTGAAAGTGAGGTAGGTAAACGAGTCAATAGTAC
AAAGGGCACAGAACAGTCTCTAGGACGTCTAATAAGTATTAGGTATTGTTACAATCATCA
TTTAGGAAGGAGGAAATGGACCCAGGTTGGGAGATGTGGGTGCCTAAACGATTTCACTGA
AGGCTTTCACCTGATGTCCTTGAGTTCCTGAAAAGTCCTGAAAGTTCCACGCTGGTTAAT
AAACTCATTTGGTGTGGAAGCTTATGTCATTTTCCATCTCCGCGCCTCACACTTTTCAGC
TATGAGTTTGGACTCTAAATTCTGATAAACCTGCCCTTTCCTGTCTGCCTAAAGAGTCTC
CTTTACGCTTTCCTTAACGCCTACTTTACACAAAAACTACATTTCCCATGAGGCCCCACA
GCCGTCAACGTCGCGCACCTCTTTGTCGTCGCTCCGCGCGCTTTATACTCACTTCCGCCC
ACGAGCCACTTCCTTTCCTTTCGGCGGCGCGCAGCGGCAAGATGGCGGTGCAAATTTCCA
AGAAGAGGAAGGTGAGTTTCTGGGGTCTGGGTCCAAGAAACTGCGGCGCCAGCGGGTCCG
GGCCTTCGCCATGTGTCACCTTGAGACCCTCAGTTCCGTGCCCTGCCCCGGGAGGGTGTA
GATCACCCGGCGTTCCCGCGGGTCGCGGATGGCGGTGGATTGAGTGCGAGGCCCAAAGCC
GGCAAGCGCAGGGTGGCGGGGAAGGCAGAGCGATCTCAGCCGGCTCTGGGTGGAGTACGG
ACATGAGCACGGGGCACCGCACTTGTCCTGGAGAAGGTGCTGGCAGCACTTCCTGGTCAG
CAAAACTAGTAAACGTGTAGCGTTTTGAGGGCGAGGGTCATTCTCGGTTCTTACCCCACG
GCGTTGGGAAACAGCCGTGTATCTTTGTCTTGCTTCTCCGAGTGTCGGGGTGCAGCCCTC
TGACCCAGAGGACCTCGTTTGAAAGGCTCCAGACAACGGCTTGCTCCATCTGAGGACCTT
GGGTTGGGAGCGTTTTTCGGCTTTAACTTCTTGTTGATCACCTGGGAGAGAACTGTGAAA
AGTGATTAGATTTAGAAAATATGTGGTTTGCCATTTACGTATACACGGACGTCGCTGTTA
AAACTCAACCCATAACGCTCTAGTGAGTTGGGGATCTGCTTGCTGTGAGACCACAAGGCT
GGGGATTCTCTGGATCTGCAAGCGTGACTGTCAGTAAATGACTGGCTTTCTAAAAACCCT
TCAATGAAGAGATGATGACGAGTCTGAATGGGGATGTTCTTTGTCCAGGCGGCCTTACTC
TGGCTGCGTTCTGTAGCACAGTTTAAAGGGCCCTGGGCAAAGTCATTCCTAAAGATGACC
TAGAGGCATTTGTCTGAGAAGGGTTGCTACCTTCCTGTGGGTCTTGGCTAGAGATGTTGA
GACTTAATGAGGGATGCATTGGCTGATAACCTGGACAGAGGAGGTGGAGGCTGCAGCTGT
GACCTTAATGTTGAACTTTGTTTTCTTGGTCAGTTTGTTGCTGATGGCATCTTCAAAGCT
GAACTGAATGAGTTCCTCACTCGGGAGCTGGCTGAAGATGGCTACTCTGGAGTTGAGGTT
CGAGTTACTCCAACCAGGACAGAAATCATTATCTTAGCCACCAGGTAAAAACTCACTTGA
CTAGCCATCTATCACCTATAATTGCCATGTACCTAAAGGCGATTTATTCTTAAGGAAACA
GCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCACTTGACTAGCCAT
CTATCACCTATAATTGCCATGTACCTTAAAGGCGATTTATTCTTAAGGAAACAGCCAGTG
AATCTGGCCCTAGTGAACGTAATGTTAAAGCTGCATTTTAAAAATTGAACTTTAGTGGGA
CCCAGCAGATGGCGTAATTATTTCATCTCTGGACTCAGGTAGTGAGGTAGTCGACCGAGG
TTTGAGTCCTGGACCTAGTGGCTTAAAACTCAGGCCCAGGTGCTTGTTGTGTGTACATGC
CCAAAATGCCAAGAGAAGAGTGGGAAAAGGATTACTGCATGGCCATCCTCCCTGGGAGGT
GATTTCTCACTTTCTCTCTTCGGCGAATGCACGTGCCCTGTATGTAGCAAAAATTTCTCT
CTAAAAAAATTGAACTTTAGTTTTTGTCATCTACAATATCTACCTGCTTTGTGACAGATC
AGTGAGGTTTGCTAACCACACACATCTACTGGATTTAAAATTTTGTCTGGAATTCTGAGA
GTCATGAATGGATCACTTTTTTCCTACCAGGACACAGAATGTTCTTGGCGAGAAGGGCCG
GCGGATCCGAGAATTGACTGCTGTTGTTCAGAAGAGGTTTGGCTTCCCTGAGGGAAGCGT
AGAGGTGAGTGGCCCTGCGTTATGCCAGAGATGGTTGTGGACTTGGAAATGGATTTTTAT
TACAGTGCTTACAAAGACTCAATGTCACTTTAGAGACTTTATATATGCTCAGTGAGTGTT
ACAAACGGATTGGGGTTTTCATCTCTTAAGCAGAGTGGGCTTAATTTTACAGGCCATAGT
CTGTTAATTTCTGGCGGCTACAGGATTTTATATCCAACTTGGCTATGGAATTGATAGCTG
GGGTACCCTGTTGGTCTCACTGGTATGGCTATAGGAGAAGCCCCCAGAGTGAGAGGCAGT
GAGGAATGCTTACCTGAGAGAGGTACCATGTTACACGTGTATGATGTGTTGAAAATGTCG
CTTTTATGTTTTCATCAGAATCAGTAGTGAAGGTAACCCGATGTGTCTTGTTTTTATAGC
TTTATGCTGAGAAGGTGGCCACCAGAGGTCTGTGTGCCATTGCCCAGGCAGAGTCTCTGC
GTTACAAACTCCTTGGAGGGCTCGCTGTGCGGAGGTGAGTGTCCTGGGTTTCCATGGATT
GTACTCCTCTGCATGGATTGGAATGCGTGCCTCCTGTTTGGCTGATTTAGCAGATGAATT
CTTGTTGAGTGGCAGGTCTAATCTCTGAGGGTCATAACAAGATACCACTGACCTTTGCCC
CTATTGAACTGGCAGCTGAGACGGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAT
GGGGAGCATTTTTAATATTTGCTTGGCTTTGGCCAGCCCAGTATTGCCGATTTAATTGGC
CTGGAGTAGAGCCTATGCATTGCTCTCTATCTCGGACTAATTCTGATATACCGTCAGGGT
TGGAGAGAGCACTTGGTCCGGGGAGCTTGACTCTTGAGTCTCCAGAAGAAAGGTAGCCAC
AGTTAGTTAGGTGTGATAGGAGTGGAAGACAATCACTTGGATCAGATTCTGGTCCCATTT
ATTCTCCATTAAAGGAACATTGAAAACAGCCAGCGCAGCTTAAGTCTTGTTTTTAAATTT
GGTGGGATATGTAGGTAAATTCTGTCCTTAGTAATAACCCGTCGACCTCCTGTTCTTCCA
AAGAGCCTGCTACGGTGTGCTGCGGTTCATCATGGAGAGTGGGGCCAAGGGCTGCGAGGT
TGTGGTGTCCGGGAAGCTCCGTGGACAGAGGGCGAAGTCCATGAAATTTGTGGATGGCCT
GATGATTCACAGTGGGGGACCCTGTCAACTACTACGTAGACACCGCCGTGCGCCACGTGC
TGCTCAGACAGGGTGAGCGCCTGAGAGTACTCAGGGCAGAGGGCGTTTGTGGTGGGTAGA
CATGGTTTTCCACAGATGGCTCATCTTTGTTGGGGTGAGTTCATCTGCAAGTCGCCGGGC
TTGTTTGTACTCTGAAGGTTACTGGTTCTCTGCACTGAACTGTGAGAACTGGGCTGCTCA
GATTGTCACACTGAGAGCTAGCTTGTCCTTGTCTAGCCATCTGTATACCCTTCGGTGATG
ACACGATGACGAGTCAGAAAGGTCACGTCCTGCTCTTGGTCCTTGTCAGTGCCACGTTCT
GTGGTGCTGTGCCAAGGTTCCATTTGCAAAAGTGTCCTGTCCATTGATTGATTTAGAGGC
ATTTGTCTGAGAAGGGACTGGGCCGGGGTGCTTGAGTACGCTGTTCTTCTGTCCTGCTGT
GAGGTGGGGCAGGGAAACCCCAGCTAGTTCCTAACTGTGCTGTCCTCTAGGCGTCCTGGG
CATCAAAGTGAAGATCATGCTGCCCTGGGACCCAAGTGGTAAGATTGGCCCTAAGAAGCC
CCTGCCTGATCACGTGAGCATCGTGGAACCCAAAGATGAGATACTGCCCACCACCCCCAT
CTCAGAACAGAAGGGTGGGAAGCCAGAGCCGCCTGCCATGCCCCAGCCGGTCCCCACGGC
GTAACAGGTATGTCTGCAGGGACCGCCTGGGCAGAATAGAGGCCTGCTGCTTTCTCTCTT
GGTTAATTCAATATTTGTATTCTCCACTGTGGTAAATAGTTGGTGAATGAAAGCTGGATC
ACGTTTACTGTGTATGAGGGTACATGTTGAAATCTTGGACTCTTTTTTGCTATAGGGTGT
GTGCACTTGCCAGAAAGAGACAGACAGGGAGAAATCACTCCAGGCGGGGTGGCCAGGCTG
CAATCCCTTCTCCATTCTCCTCTCAGGATCTTGGGCATGCATGCCCATGCAACCGGCATG
AGTCCAAGCCACTGGGTCCGGGACTCGAACCATGGTTGGCCACATGGGAGTCCAGCGACA
TAGCCGCTATGCTAACTGCTGGTCCCGAAATCTGGGACTCATTTAAGCTATGATTCCCCT
GGCGAGGGTGTTTACCTTTGCTCTCTTAAGAATTTACCGCTCTTGAAAATAGTTTTCCTT
TGCTGTCTTCTCTTAGTTATGTAAGATTTTCAGGGCACTCCTGCTAGTAATTAGCTGCCC
CTTAGCCAGCCCCTTAAATTAGTGGCACCAAGCCTCCTATATCCGACATGTGGGCTTGTT
TCTCTGTTGTGTTTCTAGGTGTTCTGTATTCATCTTCCTAGAAACTTGTAATGGGAAATA
TGTACCTATTTGGAAAATGAAAGAACCTCTCTTACCGCTATGTTTTATTTGGTTTCAGGG
TCCTGGCTGCTGTATCCCGGAGTCTGGATGTTAACCGTAAAGGTGTTTAATAAAATCTTA
TAAAAAGACCTAAGGTTGACTAGACTGTTCAGTATTCACGTCGAGGCTTATGTTGGTATG
TGGAGCATTTCTTTTTTTTTTTCCCGGAGCATTTTTTTTTTGATTGCAGGGATCAGAGAT
GGAGGACCAAAGCAAAGCTAACCCAGAGAAGCTGCCTGTGGGGCAGTAAATTTGCTGACA
TTGAAGGCCAGTGGCTAGCAGAGTGGCACCTAGATTCATTGATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 2013..2143, 2850..2943, 3359..3453, 4863..4996, 4998..5051, 5510..5703
1001..1030, 2013..2143, 2850..2943, 3359..3453, 4863..4996, 4998..5051, 5510..5700
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved