Tupaia_belangeri Locus ENSTBEG00000001416
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000001416
Tupaia_belangeri
ENSTBEG00000001416
GeneScaffold_2206
SNORD62
21531..21616
38492
CTCTCTGGATTCTGAGACGAAGACGGCAGGCGGCATGGCTGCGGGTCACGTGTGTTTAT
ACGTTACCAAGTTTGCTGTCCAGGGTGGGAATTTCTCTTTTTATAGCCACCAAGTTATAA
GAAAGTTGGAAATACAATGTAAATATTTTCTTCCAGAGGACTGAGTCAGTTGCCCAACCT
CATTGGGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTGGCCT
GTCAGGTATTTTTTCGATCATCGAATCTTGTTGTTCATTTCAGTGACTGGGGTTTGGGTA
GGGGCTACCTCATGCTCCCATGCAGCTTCACTCCCTGCAGACCAGGGGAAGCCTTCCCGT
TGCTGAGTACTGCTCACACCGCTGCTCTGGCAGCCGAGAGCCAGTTCTGAAACGTGTGAG
ACACCGAGTTGCTTCCAGACGTGCTTCCCCGTTTTTACGTTCTCGGCCCTTTGCCGTGGC
ACATCTGATGGTGACCTGTGTGCACTCACCTTCCTGCCCAGGGTCTGTGACTGTCTATGG
GGGAGACAGAAGCGGCCCTGTGACTTGGGAGGGCAGTCCCAGGTCCTGCTCCTGCCTGGT
ACCCCTGCCTCGTGTGCACCAGCTGGGGACATGTGTCCTTTCTCTCCTGTCCTGTGCGTC
GATCGGGGTTCCGTGTTTGCAGACTGTACTTTGCGTCTCCTTCACTGTCCCAGCGGCACC
TTGGTTGTCCCCGCTTTCAGACGAGGATGTAAGGTATAAACAGCTGGTACTTGGCGGACC
TCACCCCAGACAGAGCAGAGGATGGGGCAGGGTCAGAGCCTGGGTTTTGTTGCAGGACTG
AGCCATATCTTGAAGATGCTCGAGGACCTCCGGTGAGCTGACCTGTTGGGGTTCGTGACC
TTCCGTTCATCAGGGTCCCCTTCTCTCGGCAGAAGCCCTCCATGGGCAGCGTGTTCCGGC
AGCAGTCTGTGGAGGACAGGGAGGACAAGCCACCCCCGCGGCAGAAGTTCATCCAGTCGG
AGATGTCCGAGGCCGTGGAGCGAGCCCGAAAGCGCCGGGAGGAAGAAGAGCGCCGTGCCC
GGGAAGAGAGGTTGGCCGCCTGTGCCGCCAAACTCAAACAGCTCGACCAGAAGTGTAAGC
AGGCCCAGAAGGCCAGCGAGGCCCAGAAGCAGGTGGAGAAGGAAGCCCCCCGATCTCCAG
GCACCGACAAGGCGACCCCGCAGGAGAACGGTCCTATTGTCCGCAAAGGTGAGGGGTGGG
CCTTGTCCCCACCTGGAAACCCTGGCCCGCTGCCAGTGGTGCCACTTGCATCTCCCTGAC
TGCCTCGGTTGCAGATCCCGTGGCTTACGGCGGAGGCACATGGGGAAGCAGCCATCTCTG
CGGGCTCAGGCCTGGCAAGTGCCTTGGGTCCTGGTTCTGTTTAGGCTCCACGAAAGAGCT
GGCACAGTGCCACCTCTCTGGAGGCTGGGCCATCTGTGTGGTGGGGCGAATAGTAGCCAA
GGGACCACATGGGGTGATGTACGTGGAGCGTGCACATGGCTTGCAGCATGTAGGAAGCAT
TCCTGTGTTCACTGAGAGGCCGGCTTTGTCATCGCTGTCATTATCACTGTTACCGTTCCT
GCCTCTGCCCAACCAAAGCTGCCAGTGCTGGATGGAGGGCCTTAATAAGAGGTCAGGATC
CTTCTTCATCCTACGTTAGTTCTAAAAGGAGCGGGGCCCCCGGCTATGTAAGAGACCTGC
AACAGCCCCATAAACAGAACGAGTGTCTCCTGTGGCCATTTGCTTTGATGACTTTTTTTT
TTTTTAATCGCCAGGACCCTATGCTTATGAGAGAAAAGAAAGGGAGGGAGAGAGGGAGAA
GGCACCCCCCTAGTGGGATGTAGTCACACCGTGACCTTTTTCCTCCACTTTTCCACCCCA
CCCAGGATTTGAGGTGTGCACACACATACCTGATGTATTCCTAAGCTGCCAGCCCTTGGG
TTTTGAACCACAGTGGCCTGGATCTGCTCCCCATGACCTGTGCTGTGCTGCTGGGCGCGG
GACGGGGCAGTCCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTAAGAATGTTTTTAG
GGGACTCCCACATGGCCAACACAGTTTGAGTCCCAGACCTGGTGGCTTGCTTTCTCTGTG
TCTTGCTCTGGCAAAATAAAATAAAATAAAATAAAATAAAATAAATGAGTGAATGAATAA
ATAAAATTAAATAAATAACTCTTTAAAAAATTATTTTATTAACTTTCTATATTTATTTAT
TTGTTTTTAATTTGATCAGAGAGGGACAGGGGTGGGGGGAGTGAGAAAGCTAGCCGCCAG
GTCCAGGACTTGAACCACTGTTAGCTCTGAGGGAGTCCAGCGCCCCTAACCACCACACCA
CTTGCTGACTCCGCTCATCGTGTCTGATCTGACCACAGGCACTTCCTGAGGCTGGCCTAT
GTGCCGTTTTCAGGCCAGCTTTTTTTGCCGTCTTTTTTTGAGCGCTTCCTTGCTTTCTGC
CAGAATAACCTTTTCTGACCTCGCCTGGCCCTTGGTCCTGCCTGCCCTCCCTCAATGAGC
TCAAGACATCCCGATTCCTTTTAGCAAAGGGCATTCAGAGACCTAAATACCTGCGCCCCT
GAGTGCTCCTCACTGTCGGGGATTTCTCAGTGGACAGAATCAGGGAATGTGCGCATGTGT
TTCCACGTACGTGTGTGTACACGGGTCCATGCACACACATTCACATACACACCCTCAGTG
CCTGTCTCTGTTGAAATCTGAGTTCACGGTCATATCTCCAGCTTCTCAGAATTCATTCAC
TTCCTCCATTGCATATGAAGAGTCTAAAAACTTTGTGAAAATGTGTATTATGAGAAAGCC
ATGCACGCCTTTCAGCATTTTCTGTTCCAAACTAAGCTTGTACCTTAGCTCCATTTTTCC
ATGAGGTCCTTGGAAGTCCCCTCCTATACTTCTTGAGTCTGTTGTTCCCTTGCTAGGACA
TTATCTGAGGGGAATAATCAGAGCTGGGCGTGGCTTCGGGGAGGAGGAGGGCCGTGAGCC
GGGCAGTGGTAGTGCCCAGTGTCAGTGCCGCAGACCCGCAGCGAGTGAAGACAGCACACT
TGGCTCTCACGCCGGGCATGGGAAAGGCGTCTTCATGCCGCTGAGCTGGGGGTTTGTAAT
CTGATTACTGTAATTAGTTCTGGGTTACAAGAAGTTAATTTTTAGGTGAAAGCTCTTAGA
CTGCAGTAAATGTGTTGCCTCCTCCTGTGGAGGTGCAATTATCCTGCAAGAAAAGGCCTA
GATCTTAGTTTTCTTTTGATGGTTTTTGATAGTCCTATGTTTCTGTAACTACCATTGAAA
CAGGAAGTCATGTCTCTTTTTTTAAAGAATTATTTTATTTATCATTATTGTTATTTTAAA
ATTTGCTACAGTGGGGGCCAACAGTGGCATGTTGATTTAAGGGCGCTGACTCTACATAGC
TGACTGCAGTTCAAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGTTTGAGGGCAGACCAAGCCGCACG
TAGACACCACTTCGTGCCTGCCTGTGCCAGCGTATAGGTCGTTGTTGACAGGAGCCGGGC
GTGTGTGAGCCGTGTGCCCTGGAGCCTTTTCTCGGTATGTTAGTTCCCGTGAGCACTTGC
ACACCAGCTTGTCCCCTTCTCTGGGCTCCGAGGACGCAGTCCGTTAGCTGCGTTTCCAGC
GTGGTGGTGTGAGCCCTGTGTGCATGTGTGCTGGGAGTCGACACACTGATGGGGAGGATG
GAGCTCTGGGTCACTCGTGCCAAGTGCAGCAGCGTGGCGGGGCAGCCAGTGATGTGTAAA
GCCTTAAGAATGGAAAGAAAGCAGAAAGCCCCGGGGCAGCCTGTCTGGCCAGAGTCCCTG
GGGACCTGGGTCTAGACAGGAGGGGCTGGGGGAGGAGGAGCAGCCTCTAGGGCTGGAGAG
TTAATAGCTTGAGTCTCCTTATCAATGAGGTCTGTGTATAGAGTGTGCCTAGAAGGGACT
GTGCATGCCAGGTGGCAGGCCGCGGGCTGGCGGGTGGCCTTGTTTGCAGAGTGGAAGGGC
GTGCGATGGAAGCTTCCAGGTTGGGATCCTCAACTCACTTAGCACATGAGCCTGTGATAT
GCTGGTCAGGATTCACGGCCAGGCAGCACCAGAGGTTGCCGTGGCTGAGAGCAGGTTCTG
AAGTGGACCTTCTCCAGTCAGTGGCCCGGGCTTTGACTGTTCGTCTGACACCTTGTTCAT
CCTGATGCCCTGTGTGCCAAGTATTGTCCTTGCGGCCGGGAGACTGTAGTGAGCCAGGCA
TGCGGGTCTTTTAGGATTTAGTGAGGGAGACCAGCCTTTAAAGTAACACACTGTTTTCTT
CCTAGAGAGATTTTTGCTGTAGGGTACGTATAGTTGTCAGAGAAGCAAGAGAGAGAGAAA
TCACCCCCCAGGAAGGATGGCCACGCCCCAATCCCTTCTCCATTCTCCTCTCAAATTTTG
GACATGTGCATACACATGGTCAGCGTGAGTTTTAAGCCACTGAGGCTGAAACTCGAACTG
TGGTCAACCATGTGGGAGTCCAGTGACGTAACCATTGTGGTATCTGCTGGTCCCAAAATC
CCACACTGTTATTAGTGCTGCACAGGAGAAGTGTCAGTTCATGGCACATGGAATAAGGGA
CCTGATCTCACTTACGGGCTCATGGCGGGCTTTCTAGAGGAAGCATTTTTTTAAGCTGGA
AATCTAGGTGTGGGCAGACAGAGGGCAGGTATGTTCTGTGGCCAGAGCAGGAAGGGTGCA
GAGAACTCCTGTGTGGAAACCCCAGAGGCATGTGGAGCGAGATCCTGCAGGACCGGAGGT
CACGCGGAGTCCTGAGGAGTTCAGGGTGTCAGGCAGCTGCAGCAGAGACCCAGTGCAGGC
CCTCTTGAGCCAGTGCTCCCTAATGGGGTGCACGTGACTAGGCATATCACCCTGGTGGAG
TGTGGAGAGTGGGTTGAAGAGGAGAGGAAGGGGGAGGGTGATGACCGTCCTCAGCCGTGG
ACTAGACCAGGGGACGCAGCCAGTGTCTTGATGCTCTGGGTGCCAGGTCAGCCCCAGGCA
AGCTTGTGCCCAGGGAAAGCCTCAGCCGCTGGGGTAGTGCAGGTGCGTGTGACAGTGGCG
TGGCCGTCCATCCAGCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCCGCGGTGAGTTTGCATGA
CCGCGGCTTTGAGGATGACTGTATAGTCTGTGTGATACAGACTAGGGCATCACCAAACTT
TTTCTGTAAATGGCCTGAAAGTTAATTTAGGTTTTGTGGGACCAGCAGGCGGCGTGGTGG
TCGAGGTGTGGACTCCCACATGGCCGGTCATGATTCAAGTCCTGGACCTGGAGGCTGGCT
TGCTTCCCCACTTTCCTTCTCCCCCCACACCTCCCATCTGTCTCTTTCTGGTGAGCACAT
GTGCCCTATAGCAAATTTTAAAAAATAAATAAAAATAAAATCAGGGTTTTTTTTAAACTT
TAGGTTTTGTTCAACTAAGGTTTGCTGTTGCCGAACAAGAGCAGCCATAGGCGGCTGTAA
ACGAATGGTTTTCTAGTACAAGACATAAAAGTAGGCAACAGGCAGAATTTTGTTCAAGGG
TTCTAGTTTGCTGCCCAGCTCCTAACATAGGCTGCTCGGCGTGCATCGAGGCTGTCTTTG
TAGGCTGTGGCACGGTCCTTGTAGAAGGCATTGCATGCCTCTCCGAGAAGCACCTGTGTT
CTCCTGCTGGATGGAGTCCGTGAAGCTGAGCTTGCTAACCATCTCGTGCAAATACGTATT
CCAGTTTTTTTTCTTCATTCCATTTCCTGTCCCTACCCAGTTACTGAGAAGCATTAACTT
CTCCCACTGGGATTGGAATCTGCAAGGTGCTCCTCCGTCAGCCTGTCGCTTCCTGCTTTC
TCCACCTGAAGGCACGCGGGTGCAGCCTGCTACATCTCAGTCCTCTCTCACGTAGCTCCC
CTGCTGCCGTTAGTCCTGCTTCCTATCTGTCCTGACGTAGGCCGGGTACAGTACCGTTAG
CCTGATTTTCTCCTGATTGCTCACTGAGGTTTTGGGGAAGGGTGTCCTTGTATCTATAAG
ACATGTGGTTCAACCCACTCCAGAAATCCGTGCCTTGGTCTGCCCTCTGCGGCCCAGACT
AGAGCGTGCTGGTCTCTGGAGCTGGCCACCATGTGCCAGCTTCAGTTCCCGTCTCCAGCT
CAGCTGGCATGGAAACATGGTGTGTGCGTGCATGCGTGCCCAGGACCTTGGTGAGCTGGG
GGATGGGGATCACGGCATGCCTGAGCCCTGTGGAAAGGGCTTCTCTCTCGCCCTCACTCT
CTCCCATGCACACATACATACTTGATCACGAAAACAGAAAACTGTGATTTGTAGTTGCCA
GAATTGCCCTTTCGATGTATTGGGGAAAATAAGTTTAGAAAATATAGAATTGACTTATTA
CAATGACCGTGTTTATGTTTCCTACTGTCCTTACTTTACCCTGAACTTGCCATACTTTTT
CTTTCTTAACCTCTTCTTGGATTAGGTTTTCTGTTTCTTTGGCTTTCTTTCCTTCTGTAC
CCTGTCTCCATTTTGCTTATGTGTGCATTTTTGTTTTCTTTATTCACAGTGTAGCACGTG
CACATGAGCAGGTTTGTGGCGGGAGGGCTTTCCAGGCAGGGAGAGCCGAGTGCTCCTGTC
TTGCAATCGCACTTGTAAATGGTGTGTAATTTTAAGGCTCCAGGGAGGGTCCTTGCCACC
CCTCGAGTCAGACTTTGAATTGGAGTTGTGAATCAGCATTTTTTTAGAAAAGCTCCCACA
GGGCGTGCATGTGCTCACCAGAGAGAGATGGGGGTGGAGGGAAGCAGCTCCCCATGGGGC
GTCACCATGCCACTGTCCCTTCTCCATCTCTCCGTCCTGCCGGGATCTTGGGCGCACATA
GGTGCCCACTGTGTTTTTCAGGCTGGGATTTGAACCATGGGGTTGGCCATGCAGAATCCG
TCTCTCTTAACCACCGGACTGTGGAGCCAGCCCCATCAGCAGGATTTGAACACAGAGTTC
CACAGCCGAGAGCGAGCTTACAGCCGCTGGCCTGGTAGTGAAGCGTTTCCAGTCGGGTCC
TTGCAGTCTAAAAGATGGACACGGCAACACTTGGCTTGTGGGCTTCGTAGAGGGAGTGTT
TGACAGCTGAGATCCTGTTCTCCGCAGACTAGGCCCGACGGCCTGTCCCTGTCACCTGGG
CCAGCCTGACCACGCGGCGTGCCCAGGTTCCCCTGCTGCCTCCTGTGCTCGCCCTCTCAG
GCTAGCTGTTGGGCTGTCGTTAGTTTTGTGTCCCACTCCCTCGCACACTCAGTTTCCCCA
TACAAAAATGTGAAGTGTCGCTGTCGACTTTAGGGCTAGAAATAAAACCGAAATTGGGAC
CAGCAGATGGTGTAATGGTTATGTCTCTGGACTCCCATGTACTCGACTCTGGTTCGAATC
CCGGACCTGGTGCCTTAAAACTCACACTGGGCGGATGTGTATGCATGCCCAAAATCCCAA
GAGGAAAATGGAGGAGAAGGGATTGTGGTGTGGCCATCCCCCCTGGGGGTGATGTCTCTG
TCTCTCTGATGAGTGCATATGCCCTATCACAAAAATCTCTCTTAAAAAAAAAAGAAGAAG
AAAAGAAATAAAACCAGAATTGCTTTCTCAATCTGCTTTCCAGGTCTCTGAGCAGGCGGC
CCCGTCCCGCGTCGGCGCTCAGGCCTGTCGCTCTCCCTCGGGTCTCTGCCCTGCTGCAGG
CACACACGTCCTTGTTGCTAATTGACTTGGACACCTGTGGCCTCCCAGCCGTCGCCAGCG
GAACTGTAACTCAGTATTTCCAGTTTACACTTGGCAGTTGTACTCCGCTTCCTCCCGGGG
GTTCTCAGTCTGGGCACTGAGGTGGCCGCACCGGTCTGAGCGGGTCGGGGTACACACCGT
GTGTCTGGAGTCTCTCTCCCAAGGAAGAGGAAACTCCTCGTGACGTTTGCTGAGCGTGAT
GACCTAGACCACTTCTTTGCCGTCTTGATGGTTGATGAAACCCATGCGGCCCCCAGATTC
CCTCGGGGGGACTGGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCGTGGGGGCCCAGTGGCGTTTCCCCAGCACACTGCCTCTTCCGTTCTGACGAA
CTTCCAGGGCCACGGACCACTCCAGGGCCCAGCTGCTGGAAGTCATGTTTAAAGATAGAG
CAAATGTTGGTGCTTATGTTTTCTTCTTCCTTTTGAAAAACATTTTTTTTTTTTGTTTTG
AAACTAAGCTCTGTGTTCAGCATGGAAACCAGGAACCAAGCTCCAATCACATTGACTGAT
TTTTCTGGTTCCTTTTCAGGAATGAGAGCCCTTACTCTGCCTCCCCCAGAAGGTCAGGGG
GCGTAAGTGCCCAGCGCGATCTCTTTGAGGAGAGAGGGGAGGAGTACTTGAGTGCTTTTG
ACAAGAAGGCCCAAGCAGACTTTGACAGCTGTATCTCTGCCCAGAGCCTAGGCCAGGAAC
TCTTGTTTCCATCCCAGGAAAATGTGCAGGAAGCCGGTGCTCCCCCGAGTCACACCCAAA
GCCTCAGGTGTTCTCCACTGGAGCCTGCCTTTGTCCCAGCGGAGAACAAGCCTGACTATG
GCAGCTGGGACGGTGGCCTTCAGCCCCAGGCAGCCGACACAGCCGGCAGCGTCAAGCAGG
AGGCACCCAGGGAGGAGCCGTCCTTCAGCGTTCCCTCCTGGGAGAAGGAAGGGAGCCCCG
GTAGGCAGACATCCTCAGAGCCTGAATGGACCCCTGAGCCCCGAAATGCCAACAGCCAGC
CCCAGGAGCAGCCGGGCAGGACCCGGAGGTCAGGCCCCATCAAGAAACCCGTGCTCAAAG
CCCTCAAGGTTGAGGAGAAGGAGAAGGAGCTCGAGAAGATGAAGCAGGAGCTTGGGGAGG
ACAGTGCCCAGGACAAGGAACCCTTGCCAGGCCGGGAAGGGCGGGACGAAGAGTATGCCC
CGCCGGGGCAACTTCACCCCATCTGCAGCAGAAGGAAGAGGGCTCCCCGGGCTACCTCTG
CCACGAGCCCAGCAGTTTGAAGAGGACGAGAAGCCCGACAAGGCGTGGGAGAGCAGACCC
TCCCGAGAGGCCATTGACACTCCACCCACGAAGAGAAATAACTGGATCTTCATCGACGAG
GAGCAAGCCTTTGGGGGCCGAGGGCAGGCCCGGGGCCGAGGCCGGGGCTTCCGAGAATTC
ACTTTCCGGGGTCGACCTGCTGGCAGCAGTGCAAGCAGCCTCTGTGGTGCAGGTGTCCTG
GGGGCGCGTGGCATCTACAGCCCCAGCCAGCGGAGCGGCCGAGGCCGTGGGCTGCGAGAC
TTCGCCCAGCCCGAAGACGGGCCCCGAGCCAAGCCCCGGCGCAGGATCGCCAGCGAGACC
CACAGCGAGGGTTCGGAGTATGAAGAGCTTCCCAAGCGGCGGCGGCAGCGGGGCTCCGAG
GACGGGAGCGAGGGCTCAGCCCTGGAGCGGGAGGAGAGCGCCCTGAAGAGGGGCGATGCC
CGAGATTCCTGGCGGTCCAGCAAGGTGTACCCCGAGGACCCCGGGGCACTGGACGCCAAG
AGCCGAGGCCCTCGGGCTTTCGGGCGAGCCCTCCCTCCCCGGCTGAGCCATTGTGGGTAT
GGGCGGAGGGCCTTTGTTTCCAAAGAGTCACCGCACTGGCAGGGCAGGGGCCTGGGCAGC
TCCTGGCAGGAGTACGGCCCGACCGACACGTGCGGGGCACGGCGGCCCACGGACCGGGCC
TGCGCCCCAGACTCCTACAGACACTCGGAGTCGTTTGGCGGCAGGGCCTTGAGACAGCCG
CATGAGGACAGGAGGTCCTTCTTCCCAGACGACCACGGGGCCGATGCTGAAAACGCTGAG
AACCGGCCCTTCAGGAGAAGGCGCCCCCCGCGCCAGGACAAGCCTCCCCGCTTCAGGCGC
CTCCGGCAAGAGCGGGAGTCCCTGGGCCTGTGGGGGGCCGAGGAGGAGCCCCGCCTGCTG
GCAGGGCAGTGGCCAGGCAGGGCCAAACTCTGTCCAGGGGACAAGAGCGGCGCTGTGGGC
CGCAGGTCCCCCCGAGCTGCCCTACCAGCACTCCTCTGACCATGCCAACGAGGAGTGGGA
GACGGCCTCAGAGAGCAGCGACTTCAGTGAGCGGCGGGAGCGGCGGGAAGGCCACAGTGC
CGAGCCCGACCCCCAGGGGGACGGCGGCCTGTCCGGGGCCAGTGCAGGAGAGAAGAAGGA
GCTGGCCAAGAGGAGCTTCTCCAGCCAGAGGCCCCTGGCCGACAGACAGAGCCGGAAGCT
GGAGCCGGGAGGGTTTGGGGAGAAGCCCGGTAGGCCAGGTGGTGGTGAGACCTCTCCCCG
TTATGACAGCCAACAGAATGGGACGCCTTTGAAAGCCAAAAGGTAAATGGGACACCGCCC
CAGGCCCTTTGTCGTGTTGCTCCGCGGCACTGGGCCCGTGCATGCGTGCTGCCGTGTCGG
TGCCGCGGGTGCTGCCCAGACCCTGGTGTCACGCCTCCGTTACCGCTCTTGCACCGCTTG
TCTGCTACTCGTGATGTCGTGGCTGCCACGCCATGGCTAGAAGGCCCTCCCAAGGGGCCT
CCTGCCGCGGCTGCCCTAGTGCCTGTCCTGAGTTCAGCCTCTGTTCGTTCGTGTGCTGGG
AGCCCACCTAGGGGCCACTGCAGTAAGAGATGCTGCCTCGGGTGGAGCCAGGTGGGCACT
GGGGAGGACCCCGGGTCCCTGCCACCCTGCGTCATGGTGGGCACTGGTGCCTCTGGCTAT
GCTGAGGTGGCTCCTGCCTGGGGTCTCTGCTTCTCAGCAGCAGGGACAGATGTGACCTTG
GTGCCCCAGGGTGGCTCCTCCGCGAGACCAGAGCCCAGAAGGAGCAGTGGGGTGGCCCGG
CCTGGGGCCCAGGGGGCATCTCTTCTCAGAATTAGCAACTTCTGGGTGGCTGGTCTGTAC
TCAACTGCCACAGCCTCCCCCATGGAGGACAGAGGAAGGCCTGCCATCCCCTCACGCACT
CATCAAGACCGCACCTCCCTTAGAATTCAGGGCTCAGAAACCTGGGTCACGCCCCAGAGA
AGGAGCCCCAGAGGAGGAGGCCGACTGCTGCAGGTGTGGGTCTAGCTCTCCAGGTCCCAG
ATGCCAAGGTTGAGCTGTGCTTCTGGCTTCTGCCAGAGCACAGCCTGGGTTCCTTGTTGG
CCAGAGCCCCCGATGAAGGCAGAAAGGTCTGGCAGGTGCGCCTCTGCCTCCCCTGCAGTC
TGTGACTAGCAGGAGGAGTGAGTGAGTGTCCTGGGGTGGGGCTGGGTAAGGTGGTTCCCT
GCACTGGGCAGTGCCACGGGTGGCCTTCTGTGGACTCACACGGACGCGGTGCCTGCCTGC
AGCGGGTGCCTGCCCCAGGGCTGGTGAGGGCAGTGGGCCCAGGCAGTAGGCGCTGTGTGT
GTGGCCAGGTGCATAGGTGGTTCCTTCCCAGCCCTCCATCGTCACGGAGTTCACAAGGTC
CGTGTCCTTTCCAGGTCCCCAGAAGAGGCCTTGCCAGGAGGGCTTGGTGGCTGCAGTGGT
GGGAGCAGCCACTCGCCCTATGCCCACACCAGCGCTGACGTCCCCGAAGCTTCTAGCAAG
AAGGCAGAGAAGGAGGCAGAGGTGGCCGCTCCGAGGGCCGGCGGCCAGGGAGAGGACCTG
AGGCAGTTTGACTTGAGCTATGGAAGTGAGTCCAGTCACCCTCGGGGAAAGGGGACCCAG
GTAAACCGAGGCCTTGGCATCTCCAAGAGTTGCCCTTTGCCTTTGTGCTGACCGTATGTG
CGCCTGAGAGCAGCCCCCATCAGGCACCACTGTGTTCAGGGGCTGCAGAGGTGAGCCTGA
CAGAAGGCCTCGCTGGAACCCCATAGCAGCACCCCTGTTTTCCTGTTGTAAAGAAGGGAA
GCCTGCCCCTTGAGGTTCCTGGAATTGTCCGGGTCACTCAGCTGGTTAGGAGCAGAGCTG
GCATTTAAGTGTACCCATCTCAGAGACTGTCTTCGTGCTGCGGTGCCATCCAGGCCTTAC
TCGTTGGAGGCTCCAGTGTGTTGCCTCGTGGGGCTGGGGAGGGGTGCAGACATCACAGCC
AGGCTTGCCCTCGGCCTGCTTTTGGGAAGCATTGCCTATTATGGGTTATACGTGACTTCA
AACAAATGGAAACGCCGTCTCTTCTCGTGGGATCTCGGTTCAGATGCTATCATTGACGAC
TGCGCCTCCAGCCATGTGGAGGAGAGCGAGGTGGGCTCTATGGTGGGCGAAGGCTTCATC
GAAGTCCTGACCAAGAAACAGCGCCGCCTGCTGGAGGAGGAGAGGAGAAAGAAGGAGCAA
GCCGTGCAGGTAGGGATGCAGGCAAGGCATCAGGCAGGGCTGGAGGGTCGCTGGTGGCCG
AGAAGCCCAGGGCACAGATCGTTCAAGGCCAGGGTGGGGAGGGAAAGGGAGGGCATTCTT
GAGTATACGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGTCAC
CGACGGTTGAGGTCTTGGAGATGAGCATTCCAGACACCTGGAGCTGTTTCAGGAGGTGTG
GTTGGGCACCGGATCCTTTTCCCCAGGAGCCCTGCCGTCTCCATGCCCTAGGCTAGATGA
CATTCCTTCTCCCCCCTCCTTAGGTGCCTGTCAAAGGTCGAGGCCTCTCTTCCCGCATTC
CTCCTCGATTTGCTAAGAAACAGAACAGCTTGTGTGTGGAGCAGGGCGACGTGAGCGTCC
CAGGCAGTAGCCTGGGCACCGAGATCTGGGAGAACAGCCAAGGTGAGAGCCGTGGTGTCC
GGGCATGGCCGCTGGGCCTGGGTCTCCTCAGGGAGTATCCTGTGGGAGGAAGAGGGGACC
TCCCCTGTTCCCTGGGCTCCTCTGCTGAGCCCAAGTGTCAAATACCCTCAGCCTGTTGGT
GCTGTGTCTCCTGAACAGATAAGAATATTCTGGCCTAAAGTCGGTTGGAGGGGCCAAGCA
GCTCTGGGGAAGGGTAGCCCGTGAGCGCAGACTCAGGGACTGGGTGTGGCTTTCTCTGCC
CATGTCGGTCACCCTTTCCTCCTTGCCCGTGGACAGCAGCAACTGACCAATAGCAAGGCC
GCCAGGGACGAGCTTGCTCTTCCTTGGGCCATGTGCCTTCCTTACACAGGAAGAAAGTTC
CCCAAGGCCCTCCCTAAGCAGCATCAGGGAATGGCAAACTGGAGTCTATGGAGTGGTATA
TCTTACCTTGTGGAAGATTCCTTTCCCTAGAAAATGTTTTAGAAGATATCTTATCCAGCA
ACCAGCAGATGGTGTAGCGGTTACGTTGCTGGACACCCATATAGTCGGCCACAGTTCTAG
TCCTGGACCTGGTGGCTTAAAACTCACACCGGGCACATGTGCGTGTGTACCCAGAATCCC
GAGAGGAAAAGGGAAGAGAAGGGATTGTGGCGTGGCCATCCCATCTGGGGTGATTTCTCA
CTTTCTGTCTCTCTGGCAAGTGCATGTTCCCTATAGCAAAACTCCCTGGGGGCTGGGGAG
GTGTCACATCCAATGCATCTTCGGGTAACTTCTCACATTGAGCCGACTCCTGAGTGCCGA
CTTTGCATGGGGCCACACTGGGAGCCCTGAGGCTACACGGATGAGTAAGGCAACACTGGC
AACTGCTCTCGGGCCTGGCCGAGACCCCATTCCAGCTTTTCCACAGAGCTCCAAGGCTTC
CCGACTGGAGGCGAGGACACACACCCAGGATGGGGCTCTGGGCCTCGGTGCTCAGTGTCA
CCATGTGGCCTGTCTTCATTTCTGGGTGTGAGCCTACCATCGCAGAGTTACCCTAGACAA
TACTGAGCTTCGATCAGAAGGGAGTACGACATCCCTCCATAAAACGTTGCTGGCAATACT
TTTGGTGGGGTGAGTGAGTGAAGGACATCACAGCAGACGTACCCCAGAATCCCACTGGCT
AGTTACTGGAGCCGCCGGTCCCCGCATGGCACGGCAGCCTCCTCTCATCAGCCTTGCCCT
CAGGATTCTGCAGTGCCTCGTTGGTTGCTCAGACCAGGAGTCTAGGAATGACTTCTGAGG
GCCTTGGCTCTAGAATAGCATGTTTTTAAAAGGGTTTCTATTTTTTATAACATTTTTTCA
TTTGTTCAGAGAGAAAGAGAGATACACACACAGAGGGAAAGTGAGAAAGCAAACCACCAA
GTCCGGGACTCGAACAGCAGCCAGCCACAGAGTCCAGCGCCATAACTACCATGTCAGTAC
TTTCCCCAATTTTATTTTTTAAATTTGCAGTAGGGTGCATGTGCTAGCTGCTGGAGGGAT
GGAGAGAGAGAGAGAATGAATGAATGAGAAAGTACCTCCTAGGAGGATGGCCATGCTGTA
GTCCCTTTTCCATTCTCTGGGGATGTGTGGCACATAGACACACACACACGTGCACAATGT
GTTTTCCAAGTGACCAGGTCTGAGATTTGAACCACAGTCAGCCATGTACGATCCAGCTGC
CTTACCCTCCACCCTGGCTGCTGGCCCAAGTGCAGATGATTTGCTGGGCTCAGGGTCCAT
GACTTCTTCAGGGTCTCAGAGGCCCTTTTTTAAAATTGAACTAACAGCGTTTGAGTGTCC
CCCGGCTGGATCTTCGAGAGACTTTGTAGAAGTTCCTCACCTTTTAGGATAAAGAGTTGG
CGTAAGTGTAGGAAAGATCAGTGCAGTGGAAGTGGGGGTGCGCCCTCACTGTAGGTGCAG
GTAAAGGTCACTGGCTTGCCGTGGCAGCTGACCAAGCACTGACTGCTGAGGAGCATGCAT
GGAGCCCTGGGCGGGCTGCCGGTGTGTTGGGGATGCACTGGGCCATGCTGACCGAGGTGT
CGCTGCAGGGCACAGAGGCAGGGCTGGGTTTGTAAGCTGCACCTGGTGCCATTCCTGTCT
GCTGCTCCTCAGCGCCCTGACTCCCCTCTGCAGCCCTCCCCGTGCAGGCCTCCGCAGGCG
AGTCCTGGAGGAAAGCCGTCACTGCCTTCAACGGCGCAGAGCCCGGCGCCGCCGAGGTGA
GTGCCCTTGCCATCCGCCCGGCCGGCTCTCCCACACCTTGTTTGCCCCAGCCTGCTCGAG
CCTCTGCCGCGGCATCTGAGCCTGGCTGGGAGCTGTTCTCAGGCCTGGGCTCACCATGGT
CCGCAGTCTGGTTTCTGGCCTGTGCAGCGCTGTGAGCGGGAGAAGAGAAGAGATAAGAAG
GGAGAAGCCCACCCTGGGGGGAGGGATTCGGGGTCTCTGCTGGACAGGTCGTAGTACTCG
CTCCACTGGCTCGGCAGTCTCTGTCTAGGGCCCACATGGTCCCATGAGGCCGAGCAGGGT
GGGCACGCTGGGCGTTGAGGGAGTCAGGCCCCGTAGGCTGTTAGAACAAGAGCAGCACGA
GGCTTTGCAGGGGCAGGGAGCGGGTAGAGCTGGTCTCCGTGGTGCACAGTCTCATTAGGT
GAAGGTCAGGCTTTAGTGCGTGGACGTCAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCTTAGACTCGATTTCAGCTGCACCTGCTCTGCTCTGTCTGCGGGATCGTGTCAA
ACTGCAGGACGCACTGGCCAGTACTGTAAGTCTGCCCCCACACCCCGCAGCTTGTATACG
AGAAGGGACTGAGGGCTCCGGGCTCCGGCGGCCTGGGCGTGACTGTCAGGCTGCCACAGT
CCTCAGGCAAGCTGCATGAACGGTCCGGCCCGTGCGCCGGCTCCTTTGAGCCAGGTGTGG
GCTGAGACTGGTAGGCTCCTTTTCACAGCTAGAGGGGGGAAGCAGATAAAGCAAAGTGTC
CCCTCCACCACCCATGGTCCTCACAGTCTGTGGTCTGTTGTGTCCATAGCCAAGCCTGTG
GTGGTGTCGTATCTGTTGGCTGCTCTATCCCTGGTACCTGGTGGGGTAGGAGCCCGGTAG
ATGGGTGGAGTGGGTGAGAGTCCTTGGGCAGCGTGCCCCAGAGGGGCCTCACGGGAGGCT
GTTGGCGGTGTTGGTTAGCATCCCAGGAGGAGGGCTGGGCAGCCTTTGGGTTCGAGATGT
GGGGCTGACCAGGAGCTGTGCTCTCTGGTGCCTTAGCCTCGTGGTGTAATCGGGACCCTG
GGGGTCTGCGGGAAGAGGTTCTTGGTGTAGCACCTCTAGCCTCAGAAACCTCCTTCTCAG
GGCCCTTCGGGGCCCAGTGACTCTGAGGGCTTCGGCTGTTCTGTCTCGAAGCCAGGCAGC
AAGTGCTGAACTAGCTGTGTGCTGTGGCCAGTCCGTTTGTGGCTGGGATGGGCGCAGCCC
TTCCTGGAGGTGTGGTGGGGACGCTGCATGGACGTTTGTTGAGGAAATGTAAAGGCAGCC
GTCTGGGGATCAGCTCTGGCCACTTTACCTTGGGCTCGAGGACAGCCAGCCAGAGCGACG
GTGCACTGGGTCCGGCTGTGTCGTTCTCTGCTCCTGTGTGTGTCCCATGGCTCCTCTCCC
CCTCCAGGCAGGGTTGGCACAGAGCATTCCTATCCTCCGGCGGGATCATCACATTCAGAG
GGCCATCGGCCTGTCCCCGATGTCCTTCCCCACCGCCGACCTCACTCTGAAGGTAACAGC
AGCCCTGAGCTGGGCAGGGGTGCACGGGGTGCAGCTTGGGCCTGTACTGTCCCCACCATC
CGGTAGTAATCTTCACCCCCCCACCCCCCGAAGATGGAGTCTGCGCGCAAGGCTTGGGAA
AACTCCCCCAGCTTGCCAGAGCAGAGCTCACCAGGAGCGGCCGGCTCTGGCCTCCAGCCT
CCATCCTCCGTGGGCGCCTCCAGCGGGGTCAACTACAGCTCCTTTGGCGGAGTGTCCATG
CCGCCCATGCCTGTGGCCTCCGTCGCGCCTTCCGCGTCCATGCCAGGTATCTCACCCCTG
CCGGGCTTCAGGAGCCTGGTCTGCTCAGTACTGAGAGAAGAGCTGGAACAGCAGCCCTGC
ACACCTCCTTGCCTTCCACGCTCACAGAGCGTGTGCACGTGTGAATTCGTGTTCTGGCCA
TGCGCTGTCGATCTGTGCCCTCCCACACCCCATCCTGTGCAGGGCTCTCCCACCTCCTGG
GAGGAACCAGCCGCCCCGCAGTGACAGCTCACATGAGATGTCTAATGAAACGGGTGGTGA
GGGTTCTCTGTAAAGTAACCCCCGCCGCAAATAAACCTTACCTGATCCCTATCTTAGTGT
CACCTCCCAGCCACTGCGTTGGTGTCCCACAGGAGGGCCCTGCTGCCAAGGTCTCGGTGA
TGGAATTCCAATAGATCCTTCTGACCCTGCACTGTGGACTCAATCGCAGGGGGGTGACGA
GGACAGAGACTGAGAGACCGAGGCAGCCCTCAGATAGAGTGCACACCCTCCGGGTTGTCC
AGGCCAGGTGGTGAGTGGCGGGTGGGAAAGACTGACTGGAGGTCACTTCCCTTCCCTCCT
CTGGGCCTGAGGCTGTGCTCTCAGGGTCCCTGGGGGCTTGCCAGGGGTACTGTAAGAGCG
TGTGGGCAGAGACCCTCACCAAGCGGCCCGAGTGTGGAAGCAGTGTAGAAGGTTTCCTTG
CAGGGACAGTCAGGAATAGCAAGGCTGGATCCATCTCTGCTTCTCGCTACATCCTTTTTC
CAGGAAGCCACCTCCCGCCTCTGTACCTGGACGGCCCTGTGTTCGCAAGTCAGCCGCGGC
TGGTCCCTCAGACCATACCTCAGCAGCAGGGTTATCAGCAGGTGATGGCGGCCGGGTGGC
TGGGGTGGCAGGCGGGCAGCACGGGCACAGCTGCTCCCGTCCGTGTGGCCGTTGTCCGTG
CCCCTCACGCGCGCCCCCACACCTGCCCTGTGTGGCATCCAGGACATCTTTGTCAAGTGA
ATGGACAGGGGACAGGAGAGGAGCGGAGGGGCTAAGTACTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCAGGTGCTGCGGAGCATG
GAGTTGCGTAAGGGGACCTTCTTGCTTCTGACTGTCTCTCCTTTCTCCCTGCAACCCCAA
GCTGTGAAGCCCCACACCCTGGCTCACCAGCTAGCCCTCCCCGCATTGCTACGAGCGTCA
CATCACAGAACCAGCGTCTGACCCAGGGCCTCCTTCCCCTGGGCCTGTGAGCGTGCTTTT
CACCTGTGAGGGCGACTCCCCCACTTGGCCTCGGGCTCAGTCTCTCATCTCCTATTGTAG
TTTTGGTGATTGTATTAAACAAAATTTATTTTAGATTCTGGCTATAGGGCACGTGCACTT
GCCAAATGCCAAGGGAAAGTGAGAAATCGCCTCTAGGGGGGTGGCCATACCACAGTCCCT
TCTTCTCCATTCTCTTCCTGGGATTTTGGGTACACCCGTGCGTGCACCCAGAGCGTCAGG
CTGCTGGGTGCAGGACTCAAACCACAGAGTTGGCTGTGGGATCCAGGGCCTTAACTATCA
TGTCACCTACGGGCCCAGTTTTGGTGGCTTTGACGTCTGCGTAGATGAACCCCCGGGTCT
GTGCCATGGAAGCTGCACCTATGCTTGGCCCTTGAGCGCCTTCCCTGTCCACCCTCTGAG
TCGGATAGGTCACTGCAGCAGCTGTGCCTCTTCCACAGTCTCAAGTTTAAGGACCCTACA
CCTTTGTCAGCTCGGACTTCTCTAACTCCCTACTTCTAGTGACCCGAGGGTCCGAGTGCC
CACCTTCACCATCCCGTATGCCTTTGGCATCAAGCCCGGCTCCGCCTGCTGGCCACACTG
GCAACCTGCCCTGCAGTCCCTGGTGCCTGCTGCCCCAGGGGCACACATGCCACTGCCAGG
CTGTACTGTGAGCCCTTCAGCACCTCGCCTGCAGCGTGCCACTGTGAGCCTGGCAGCCTT
GGCCCCAGGGTCCTCCTCCTCTTGGTCCTAGTCGGCTTCTCCTGTCAGCCACAGCATGCT
CCATCCCCAGGCTGCCCTGCCCTTGTAGCTCTGCAGCCACGTGTGGCCTGCGGGCCCTCA
TCCCAGTAGCCCTCACTGTCACTTGACTCTGGGGTCTTGACTCATCTTCCCCCTGCCCCT
CACTCTCTTTGCCTTGGCCACAGTGCAGCTCCCACTGCCCTCCCTGGCCTGTGGCAATTA
TCCACCCCTAGCCCGTGTCTCTGGGCCTCCTGATCCCGTAGCTGTAAGTCACATCCACGC
TCTCTTCACTCCCTGGTTCCTGTCTTCAGCTAACTCTGTCCCCTGGACGTGATTCTCAAA
CTAGTGGACTGCCAGCGTCTCTGTGTTGATGCCTTGTGCCATCTTGATCATACCATGAGC
AGACCTCTCCCCAGTCCCTTTGCTGGCCCATCCTCATCTTCCAGCCTCCCTCCTCACTGC
CTCCTCTGATCCTTCAGCAGGTCCTGTCAGCTTCATCTTGACAGCATTCCGAGTCAGTGC
TCTACCGACTCCGCCCGCTCGTCCCGGCATCTGTGCCCTCAGGCTGCCGCTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCATGCCGCTGCCCCGGTACGGCTCTGGGCAGCAGCCGCTCATCC
TGCCACAGTCCATTCAGCTGCCGCCGGGACAGAGTCTGTCTGTTGGGGCTCCCCGAAGGA
TTCCCCCGCCTGGGTCCCAGCCCGTCCTCAACGCCAGCAGAGAGGTAAAGTGAGCTGGGC
CCCGCAATCCCACCAGCCCCCCACCCCTGTAGGAACTGCTGCGTGGTGGTGGGTGCTAGC
GCCTTAGGTGCTCTGACCTCGCCAGACTGCTGCTCTTGTCGGAGCTACGGCGTCAGGAAG
CTGTGGTTTGGGTGTGAGCCAGCAATGTGAGCAGCCACTGGAAGGGCAGGAGGGAGGGCG
CACACCCTGGTGTCTCAGGCTTGAGACTGGAGCCATTGCTGGTGCAGGGTCTTCCTGCCC
AAAGTCTCCCGAGCGTAGCCCACGGCCGAGGGCCAGGAGGTCACAGTCCTCTCAGCTCTG
CTGTGGTGACCCTAGGGCAGAGGTGAATGAGCAGTGTGGCCAGGCCCCTGTGATCCCCCC
TGCTCCACTTAAAAAGAAAAAATATAAGCTAGCCAGTGGTGTGGCTAAGGTGGCTGGATC
CCACGTGGCCACCTGTGTGGTTCAGTCCCAGACCCAGTGACCGTGTGCATGTCCCAAATC
CTGAGAGAATGCAAGAGAAGGGAGTGCAGCATGGCCATCCCCTGTGGGGGTGCTTTCTTG
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTAGTGAGTGTATGTACCCTATGT
CCTATAGTAAAATAAGATTTTTAAAAGAACAAAAATATTGCAATGGTTCGTAGTTCTAAG
AAAAAGCTCTCTTCTGAACCTGGACTGCAGGGGGAGAGATTGCAGCTTCTCTCCAGAGGC
GTCCTCTGGAAATCCCTGTGACTCTCACGTTTCTGTTCAGGGTGGTTTGGTTGTAGGCCA
AGCTGGTCTTCAAGGCTGACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAT
AAGACCTGCGGGTCCAAGAACCATACCTGGTGGGAGAGAGGGAGAATGGCCCTACTAGGG
TCCCTTGCCTGACCTCGCCCTCTGACCCTGGCCAGGGGACTGTTTATTGCCGACTGTGGT
GCCTCTCTCTCTCAAACTGGCACCTGCTTTTCACTTTCTCTGTTTCGGTCCCCGCCTCCT
GTGACTGTCCCAGGCCCCCGTCACTGGATTCAAAGGCGGCCCTGTTGGGTGGTGGCGGAG
AACCGCTAGTCAAGCTGACCTTCACACCTGGGCTGGGATGGGCAGGCAGTGGGTTCTGGC
TCTGGGCCCAGGGGTGTGTCCAGCTGACTCTAACTACACGTGGGAGAGTCCTGGAGATCT
CCCCTATGTTTGCAGACAAGTAGAACAGACGTCGGACTGGCAGGGCCCCGAGAGGCTCAC
ACTGCCCGCCAGGTGCCAGGAGCACCGCGGGAACACGCAGGTGCCTGCTTGATGGAGGGG
CACTGTAGGTCGGTGCCTGCTGTCCATGCGGTGCTATGTCTCCGAGGGGGCGGGGCCTCC
AGCGCATCATTCTGCACTTCCAACCTTGTTTGCAGAGAAGGTCTTTCATGACTGCCCCTC
GTTTCATCTTTCTGTTCTCATTTTCACTATCTGGGCTTCATTTATTTTTGTTTGTTAGTA
TGTTTTGTTTCCCCACCAAGTCTGTCACATCGGCCTGAACAGCGGAGCTGTAGGAAGGGA
ACAGGCGCTGCGTGAGAGTGCTATTAGGGAGGTCGGCTCCGAAGACGATGCACGGGCTCC
CGTCCGGGAACACTCCTGTGCAGGAGTCTCCTCTTCAGCCGAGGAGTGGCAGTATACCCG
TCTTCAGAGGATATTCAGATGAGATAACACTGACGGAAGCTTCACTTAGTATTCGTAGCC
TTTGTTTCGGTAGTTTCTTAGAGGGCTGAGGAAACGGATATTTTTGTAGAACAAGGTTTC
CCAAAGTTATCTAGCAACACTGTGCTGAGACATTCCCTGTAGATGAAGGGCCCCCTGGTC
AGATACCTGGCAGGCGTACTGTCTGCAGGGTGGCACGTGGGCGCCCATGCTCGCTTGCGC
AGGGCCCATGCCACCGGCCACGAGAGTCCTGTTGAACCTGGGCACATAGCACTTCTTACG
CTTTCCACCACAAACTTCTCTTTCACCCAGCTCCGAATTAACACCCCTGGGTCTGTGGTC
AGTGGAGCACGTTTAGAAAGAAGGTACACGTTTTTGTCCTCCCTCCTTGTCTGAAAGTGA
AGACTAGTGAAGCAGCACGATTCTGGCTCAGTGCCTGGCCCATAGCCCTTCCTTCTCAGG
CACTTAGACATCAGGGTGGTCCAGACCCCTCTGAATGCTGAGGGGCTCACTGTCTGTCTG
CCCGCGGTAGGACAGAAATCTTGCCCCCAGTAGGGGCCCCGCCCCTCCTCTTCTCTCCTC
CTCCTCTGGGTGTGTCTCCTAGAACTCCGTCTGCAGGTGTCAAGGTGGACCCTTTACCTC
TTCCGCATTCTTGGCTGTCTTAGGTCTGTGGTTTGTTCCATTCCAACCGCCCGGAGCGAT
GCTCTGGCCAAAGGCCCTTCCCTGTGCTCTGACTCGTTTCTGTGGCGACGCGTTGTGTGT
TCTCACCCCTGCCTTTGGTTTTTTCAGGCCTAGCTCTGCTAGCCCCAGTGGGAAGCCCTC
TGGATCAGCAGTTAACATGGGCTCTGTGCAGGGACACTTCGTGCAACAGGTAGAAGATGG
CTTTCCAGACCTCCCGTCCTGGGCACTTTGGCCTGTCTCTCCGAGTGTCCAGCCCATTTG
AGTGCTCCTTTTATAAAGAGATACGTGCCCTGACAGTCGGAGTGTGGCACAGGAGCCCGA
CACCCTGGGTCCCTCCTGGCAAAGGCATTTCTCCTCTTAATGGGCGTCTGGATCCTTCCT
TGTCCTGCAGAGAAGGGAGGATACTGAGCCCTGAGGAGGCAATGCTAGAAGGTGGACCGT
CCCTACAGCGCGGGGCTGTCCAGCGCTTTGGGAGCCGGTCAGGACTGCGGGCTCGCGCCG
GCAGGTGTGCGTGTGCTGCTAGCTCTAGCCAGTGCTGTGTCGTATCTTTGTCTTGGCTAG
GTGGGTCACTGGCAGTCGAGTGTCCCATCTACATAAAGAGGGTTTCACAGTGGCTCTTCT
GCAGTGCTGTTCTCTTCACTCCTACTCTGCAGTGTGCGCTGGGCTCCTGGCTCCGGCCGC
TCGGGCTGGGTCTTCAGCATGTCACACGTCAGCTTTACTTGCTGGGAGAGGGGGCCCAAC
TGCTCCCATTCGCCCCTCCATACTCGGTTTCCTGGGGCCCAAGGGAACCATGTGGAGCGA
GCAGCTGAAGCAGGCATCTGGCAGGGGCTGGCCACTCTCACCCCTGCACCCCCACCCCTC
CCCTCATCCCTGTGCAGAGCAAGAGCTGCTGATTCACCGAACTCTTGATTGGGAGTCTTG
GTCAATCTAGGGTCCCGGGACAGGTTTTACCAGGTGGGAACCCGGAAGTATAGGGAGTGG
GGACGGTTGTACCATGGAAGATCTGGGAGAGCTGAGGCCTGCCCCACCCCTTGGCTGACA
TTGGAGACTCCAAGAGTAGTAGGATGCCCTTGGGGCAACCTGAAGGGCATAAGGGCGCTG
ATTTGGAAAGGTTCTCCCGGCAGCCTTGGGGCCACCTGCTAATGCCCTGGGATATGCCTT
CAGCCTCTCTGAATTAGTGTGCTCTGTGCTTACAGGGAGGGCGCAGAGTAGTCACCCGCC
AGTGTCCCCTCCCCCCCAGAGTGACTTTAAGTCTGGTCCTTTGATGGGGGCCGGACTTCT
TAGGCACCTTACTCTGGCTCAGGAGCAGGATGTGGGTGGTGGGTTGGGACCCAGACAGAT
GTTTCTGTGTTAGGTCACTGTGTTTCATGTGTCCAAAGGCAAAGCAGCGAGTGGATGAAA
AACCCAGCCTGGGAGCCGTGAAGCTGCAGGAGGCCCCCTCGGCTGCCTCCCAGATGAAGC
GAACTGGAGCAATCAAGCCTCGGGCGGTCAAAGTGGAGGAGAGCAAGTCCTGAAGGTGCC
CGGCCGCCACCTCGCCTCACCCAATGGGGACGGTGCCGCCACTCAGCCTCACAGAGCCCA
TGCTCAGGAACCTCGCCAGACCCACTGTCCCAACGCCTGGCCTGGACCGAGAGGTCTCCC
TTCTCTTCTCCACTCCTGAAAGCTCCATTGTCAACCAGCTTGCACCGTGGATAGACGGCA
ATGACCCGCTTGCTTTGATACAAAACGAACAGATGAGCAGACAACTCCTCCATCCCCTTT
CTTCTGTGACCGTGGAGTGACTCCGCCTCTGTGCAGTGTAGACCCGCCCGCCCGCCCAGC
GCCAGGGGCCAGGGGCCTTCTCGGTGTTTCTGGCTCAGCCTCCCTGTCCCTGAGCACTGC
GGTTTGGCAGCAGGGTCATTTTAGTTTGAGGCTTTTTGTTTTAAAAAGCAGCTAAAGTTT
TTACAAAGGGGAGAGAAAAGGAAACAGCCGAGCTGCGAGCACGTGGCTGAGCTCCCGTGC
GGTCTCTGCCACCACCACCCCGCCCTCTGTCTCCAACGGTTTCCTTTAACCTCTGTCCGG
TTTAATTTGATCTTCCCTGCGGTACCTTCGGAAATGACGCTCTGCGTGGCCCCCCTGGCC
CCCCACCTCTCCAGTGGTTATCCTCTGAGGTTATTTGCTAAAAAGAAGTGGAGGTCCGTG
CGGGCCCAGTGGTGAGCTGTGTCGTCAGGTCCCCTGAAGCCTAGGGGTCTCCGTGGGAGC
CGGCTGACAACGTCTTAGCGTAAAGGTGGCAGAGTGTCTGTCTCAGGCACTCCGGGCACC
CACCACTGGAGACGGTGCTGAGTCACAGTGATTTCAGGTTGGCTGGAGCTCACCCCCCCA
CCCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1307, 2268..2458, 6980..7175, 10589..10637, 10789..10956, 11359..11959, 11962..11966, 11969..11981, 11984..12006, 12008..12047, 12050..12058, 12061..12072, 12075..12818, 12821..12829, 12832..12840, 12843..13086, 13088..13421, 14534..14724, 15223..15368, 15743..15881, 18033..18115, 18941..19132, 19233..19430, 19800..19823, 19828..19830, 19833..19853, 19855..19884, 20767..20871, 20973..21165, 21903..22000, 25994..26121, 26222..26462, 33071..33223, 34193..34284, 36087..36168, 37358..37492
1001..1307, 2268..2458, 6980..7175, 10589..10637, 10789..10956, 11359..11959, 11962..11966, 11969..11981, 11984..12006, 12008..12047, 12050..12058, 12061..12072, 12075..12818, 12821..12829, 12832..12840, 12843..13086, 13088..13421, 14534..14724, 15223..15368, 15743..15881, 18033..18115, 18941..19132, 19233..19430, 19800..19823, 19828..19830, 19833..19853, 19855..19884, 20767..20871, 20973..21165, 21903..22000, 25994..26121, 26222..26462, 33071..33223, 34193..34284, 36087..36168, 37358..37489
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved