Tupaia_belangeri Locus SLC25A3
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SLC25A3
Tupaia_belangeri
SLC25A3
GeneScaffold_484
SNORA53
1527..1769
3799
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTTAAACTTTTTAGACAGAAAAAGATCTTAGATTTTTCTGACT
CCCCTTTTTTTAAACTGAAGAAAAAGATCAAATGAAGGTGAGTTGCATGCCTCAAATCGT
AAGACTGTTTTAGCGGAGACAGGATGAGAAACGGGAAATTTCTTTCATCTTTCATATGCT
ATTAAATTCCATTACCCTTTTTATAATACTATATTCTCTATATAAGTTGGATTTTGAGTT
TTTAAAGAAGGGTTTGGGATTCCTTGTGTGGTTCCAGGGCTAACTATATTTAGTACCTAA
ATGTTCAAAATCTATTCACAGGGTGCTATAGCTAAGCATTTGGCTAATAATTTATAAGAG
ATGACATATTCAATCTCATGATGTATTCTTAGCCATGTACTTGTTTGATAAATACTTGTA
AAATGCCTAATGTTTAGTTGTTTTGTAGAATTGTCACTAAAAGTGAAGTTAAAAAGCCAT
TGCAACAGCCATTCATGTCCCTTCTGTGTTTTGCATTTCAGGAGAATGCATATCTCTGGC
GTACTTCACTGTATTTGGCTGCCTCTGCCAGTGCTGAATTCTTTGCAGACATTGCCCTCG
CTCCTATGGAAGCTGCTAAGGTTCGAATTCAAACCCAACCAGGTTATGCCAACACTTTGA
GAGATGCAGCTCCCAAAATGTATAAGGAAGAAGGCTTAAATGCGTAAGTAAACATTTTAC
TAAATAAACACTTAAGTGTTAACTTTGTAGGGAGGGGTTTGTTAAGTTTTTGTGACCTCT
TTTATGTTAAGAATTTGCAAGCTGGTGATTAAGGCCCTGGATTCCCACATGGCCAACTGT
GGTTTGAATCCCAGACTTGGTGGCTTACAAATCATGCTGGGTGCATGTCGTTTGCCCAAA
ATTTTGAGAGAGGGGTGAAGAAGGGATTGCAGTGTGGCCATCCCCCCATGGGGGTGATTT
CTCACTTTCCCTCTGTCTTTCTCCAGCAGGCACACACCCCATATAGCTAAATAAATAAAT
AAGGCAATTTGCATGTAGCTAGGCCACAACATGCTTCCTTAGATCCACCTTTGTGGATGA
ATCTTGAACTGAGTTCTACTTGTAAACCTTGTTTCTTGTAGTTCCAGTCAAAAAACATCC
AGCAACTTTTTTGGTTGTACAGTCAAAGGTGCTTGAGTCATTGGCATGTGAGATAAATAT
ACCTGCACATTAGTCTAAGGTTCTGATAGAAATGACATGCAGTTATGCTGCCATTTTCCA
CTGTCAGGACTTGACTGGTGTGCGGACACTTCTGTTAATGATGAAAATCTCTTGTACATA
AATAATGCAATAGTGTAAAAATAAGTCCCTTGTTTTTCTAGATTCTACAAAGGGGTTGCT
CCTCTTTGGATGAGACAGATACCATACACCATGATGAAGTTTGCCTGCTTTGAACGTACT
GTTGAAGCATTGTACAAGTTTGTGGTTCCCAAGCCCCGAAGTGAATGTACAAAAGCAGAG
CAGCTGGCTGTAACATTTGTGGCAGGTTACATAGGTATGGATTATTAGACACACTTGTTT
AAATTATTAAATATCATTTATATAGTCATCTTTTTTATGACTTTTTGGTGGAGAAATCTC
AAGGTTATAAGCAGTTTTGTATGCCTTCAGGATTCAGAACTACCTACAATTAGTTCCTAA
AAAGAATGTCTGTGGTTTACATAGTTGTTTTATAGTATGATTTGTCAATAACAAATTTTC
AGTTTAAGAGGAAGAAAGTATTGACTAGAATGTGAATATAAAAACTTTTAAAGGATTGGT
CTTTATTGTAGACTGCTTTATGACCTTACTAGTATCAACTACATTTTTTTTTAAGAATTA
AAAAAATTATTATTTGAAGTTATGAAAAGGTCTTTGGCTGTGATGTGATATTTTTTGAAC
TGATCCTCATGTTGGATTGTTTATCTTGACTTTTTCAGCTGGAGTCTTCTGTGCAATCGT
TTCGCACCCTGCTGATTCTGTGGTATCTGTGTTGAATAAAGAGAAAGGTAGCAGTGCTTC
CCAAGTCCTCCAGAGACTTGGATTTAGAGGTAGGATGATTTTTTTTTTCTCTCTCTAAAG
ATAAAATAATACTTTTGAGTATATTGCATTTGTTTCATTCATATGTCATGTTCAAACAGG
TGTATGGAAGGGACTCTTTGCCCGTATCATCATGATTGGTACTCTGACTGCACTACAGTG
GTTCATCTATGACTCGGTGAAGGTGTACTTCAGACTCCCTCGTCCTCCTCCACCTGAGAT
GCCAGAGTCTCTGAAGAAGAAGCTTGGGTTAACTCAGTAGATACATCAAAGCAAATGTGG
ACTGAATCTGCTTGTTGATCAGTGCTGAAGAAAAGTGCAAAAGGAACTTTTATATATTTG
ACAATGTAGGAAATTGTCTATTCCTGATATAATTACTGTAGTACTCTTGCTTAAAGCAAG
AGTTTCAAATTTACTGTTGAAATAAACCCATCTGTTCATGATTTGTCTATGACTTGATAT
TTATTTTAAAACTAGATTTTTAAAGATATAATCCTAAAATAGTTTAACAGAATTAAGTGT
AGGTTAAGATCTCAATGCAAAAATATAAATCAACATTGTTGGTTGAATATTACAATCCCT
ATTCATTTATTTTTCACCCAAAAACCTATTCTCTTTTTTCTTTAGAACTATTATTATTAT
TTTTTTTATTACTATTTTTAAAAAATTTGCTGTAGGGTACATTCATTCACCAGAGAGAGA
GAGAAGGGAAAGTAAGAAAGCAAGCCGCCTGGTCTGAGACTTGGGCCGCAGTTGGCCATG
TGGGAGTCCAGTGCTTTAACCACCATGCCAGCTGCTGACCTCTTGTTTGCTTTTTAAGAA
GGTGCAGGACCAGCAGTAGTGTCATGGCTATGTCGTGGGTCCCATGTAGTCGACACAGGT
TGGAATCCTGGACCTGGTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1182, 1841..2013, 2438..2548, 2639..2799
1001..1182, 1841..2013, 2438..2548, 2639..2796
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved