Tupaia_belangeri Locus ENSTBEG00000010488
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000010488
Tupaia_belangeri
ENSTBEG00000010488
scaffold_75056
SNORA68
1344..1476
1947
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGGCA
GCAGGTGACTTGGAAGTGGAGACGCTGCACTCTCCCCAGGGCTGGTCGCAGTTTTAGCCC
CATACTCTGTGGTTTAGATGTAACCCCCGGGACAGGTGCTTGCATGCCCAGAATCCAGAG
AGAAGGGATTAGCATGGCCGCCCTCCCTGGGGGTGATTTGTCACTTACCCTCTTCTAGCG
AGGGCACACGCCGTGCAGGAAAAACCGGGGGGGGGGCAGAAAGCAGGTCGGGGAGTGGCA
GGCATGGTGGGACCCCTCAGCAGACGCCGTCATCCCCCTCAGGTCACATCCGTAAGGCCA
GATGGAGACTCAGCGGGCACCTGTGCCCCTTGCCTTACAGGCACCGGGGAGCTGCGTGTT
GGGGCAGGAGGCTGGAGCCATGCCCGTCTCCAGGGGGAGGCAGCCGGCCCGTGGCCGTGG
GCATTTTCAGGCAGATTCCCCGAGCATGCCCACAGGTGCATGGGGAACGGAGGCAGGAGG
GGCTGGTCCCTGTGAGTCTAGGGGTGGGGACAAGAGGGAGGCCGAGGGCCAGCGTGGGCG
CTGCTTCCTGCACTGACCTCCCCCCACCCTCCTGCCGGCAGGTGTTTGAGAAGTCCCCGC
TGCGGGTGAAGAACTTCGGCATCTGGCTGCGCTACGACTCCCGCAGCGGCACGCACAACA
TGTACCGCGAGTACCGGGACCTCACCACGGCCGGCGCCGTCACCCAGTGCTGTACGCGGC
CCTGGGGCTGGGCAGGGAGGGCGCAGGCGTGTGGGGGGCTAGGGGTGTCCTGGGGTGCAG
GTGGTGGCAGTATGCGGGGCCTATGCCATCCCAACCAGGCTGGGGGCCCTGGACCTCCCC
GGGGGAGCCTGGATTCCCTGTCATGGCGTTTGCTGGAACCCCCTAGAACCTGAGCCCACC
CCGGGTGCCCTCGGTGGTGACCAGCTCGCACCTAAACCCAAGGGCCGCGGTTTGCCGTAG
CTGCGACTTAAACAGGGGTGCGGACAGCAAGCGGACCTCGTCGCCTTTGGGGAGCTGTGG
CCATGCCCCTCAAAGTGAATCTGGAGGTCCCACACCTGTGGCCACCCAGCGGCTAGTCGG
CTGCACGCCGGGCGCCCGGGGAGCTGCGGGGCCTGGTGCGCGCTCAGTCACCCACTCCTG
CCCCCACAGACCGCGACATGGGCGCCCGGCACCGCGCCCGCGCCCACTCCATCCAGATCA
TGAAGGTGGAGGAGATCGCGGCCAGCAAGTGCCGCCGGCCGGCAGTCAAGCAGTTCCACG
TGAGTGCCGGGCCCGGGGGCGCTGACGCAGGGCCCTGGGGGGCGGCCACGCCTGGGTGCC
CGGGGAGGCCGCTGGGGGGGCTGGAGCGCCCTCCTCACCCTCCTCCTCCTCCCCCCAGGA
CTCCAAGATCAAGTTCCCGCTGCCCCACCGCGTCCTGCGGCGCCAGCACAAGCCTCGTTT
CACCACCAAGAGGCCCAACACCTTCTTCTAGGCCCGGGGCCCCGGGGCGGCACACAAATA
AACTCGGACCAGCCAGTGCGCCCGTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1130, 1569..1678, 1798..1890
1001..1130, 1569..1678, 1798..1887
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved