Tupaia_belangeri Locus ENSTBEG00000001154
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000001154
Tupaia_belangeri
ENSTBEG00000001154
scaffold_149090
SNORD61
1161..1232
6277
TGCGTTCTCGCCGCGTTCGGACTCGGGATTATCTCCCTAGAGATAGGGGTGGCGGGCGC
CATTTTAGAAACCCAAAGGTGCCGACCCATTTAAATAAAGCTGAGAGGGTGTAAGGACAG
CAAATTAGGAGGTCGGTTTCGTCGTATGCCTGTCGAGAAAGTTGGGGTGTCGCCTGCGGG
AACGGTGGCAGAAGTCGGGCCTTTGTAGTCCGGGGTGGGACGAGGCGCGACCGCGCCACC
GCGGTACCTGCATTGGGATGGCGCCGGCGCTAACCGTGGGCGTCCATGCGGGTTCCTTGT
GCGTTGGCGGCCCGGGAGAGGAAGCCCTTCGAATTTCCCAGGCGGTGCTGATGGGAANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGGGGTTGCTGAAGGACGAGG
CATAAGCGGCCCGGACTTCAGGTTTCTGGTTTGGTGTATTAGGACATCTGATGAGTGAAT
GAGTTTTTCAAAGACGGGTAGGGTGTGAAGGTCTGGGTCTTACCTGGGACCTGGATGGGT
TCGGTGGGGTGTCCTTTATAAGCCTTATGATCGGGGGCGGTGATCTGTAATCTTCGAAGG
GCAGTTGAAACCCAGGATTAGAAGCCAAAATTTGCTTTTTCAACTGTGAGTAGCTGTTGA
TTTCACACAGCCAAGGGGGAATTAAAGGGTAATGGGGTGAAAGAAATTGGCCCTTTTTAA
AGCCAGTATTAATGTAAATTGCCCTACTGCTAAACTACTTAATCTAAATTGGTTTCCTGC
TGTGGCCTAGGCATAGAAGATTGCTGTCTTTAGTTTCTAAAGAATAAATATTTTAGTAAA
ACATAAACTACAACACAATAAATGTATGCTATAAACCTGAAGGTTTTTTTAAAAAAAGGA
GATTCTGTTGTTTTCCAACAGATTATTACTGGGGGAGAAAAATGGTTGAAGCAGATCGCC
CAGGAAAGCTCTTCATTGGTGGGCTTAATACAGAAACCAATGAGAAAGCCCTTGAAGCTG
TATTTGGCAAATATGGACGAATAGTGGAAGGTGAGTTATTTATTTTACAGTACAAACTGG
GCTATTAAGATTGAAAGATAAGCTGTGATGAATTTGATTACACTGATCATCTGACATGAT
AATGTATTTTGTCCTCTAAGAAGTTCTGAGCTTTCTCTCCATATCTTGCTAGTCTCTTGT
TCTGTTATTTGAATTAGAGTAACACATTTTTCTTGAAAACTGCTTTTAGTACTCTTGATG
AAAGACCGTGAAACCAACAAATCAAGAGGTTTTGCTTTTGTCACCTTTGAAAGTCCAGCA
GATGCAAAGGATGCAGCCAGAGACATGAATGGAAAGGTGAGATAGTCTCAACAATGTAGG
GTACCATGTTCTGTCGTGCATAAGATGGTGTGACTTACTGAACTCTGGTGCAGGGCAGTT
CTTGAGTTTTAATTGTTTTGGAGTATGTATACCCTTACATCTCCATGATCCTCAGCCCTT
TGTAGTTCTATTCCAAATATCCTGCAGTTGCAGGGCTAAATTTTGTCGCCTTAAGAGTCT
CAGTTCAAAGTATTATATTACATGAGGTATTTTATCTTGGGAACCATAAACCATAATATG
ATGGCTTGACTCTTTATCTTTAGTTATTACTTTTGGTAGCAACCTGATACCTCCTTGTTC
TTGGTTTAAATTTAATAGTGATACAGTGGATTCATTCACCTTCTGTTTTGATTCAGATCA
TCAGTATCATTCTTTTTTAATTAAACTTTATTGTATTTATTTTATTAATTTAAATTTGAC
CAAAGAGGAGCAGAGTGATGGAGGGGATAGTGAGAATGCAAGACACTAGGTCCAGGACTT
GAACTGTGGTTGGCCATGAGGGAGTCCAGTGCCCTTAACCACCACACCACCTGCTGGCCC
CTGTCAGTATCATTCTTAAAGAATTTTAAGTAAATGGGAAAGTCCCAATAANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCCTTAGAGGAGGCGAGGAGGAAGTGGAGGAACCAGGGGACCTCCTTCCCGTGGAGGGG
CACATGGGTAATAACTAGAGTGGACCTTGGGGTTATATGTTAGGACCTGCAAGCTTACTC
ACATATGCTTTGGTTAAGTGCTTGAATTAAAGGCTGCAGCTTTAACATTGAGAACACTTG
TGCAGCTGCCAAAGTGGTGATAACTTAGAATGGAAACAAAGACAGCAGCCTAAGTTAACA
GTGACAATGAAATGGAATGCTACCAAGTAGTTCCTTCTGTTTATCAAAACAATTAGTTTA
TCTTTAACAGGCATAGCGTTCAACTTAGGAAGATGAAACAATTTTTACATATTTTTTGTA
ACAGATTCAAGGCCCTTCAGTCTTTATTTCTTCAGTCTTCTTTTTTCTTTTTTTTTTTTT
TTTTTTTTGTGGAGAGGTTTTTGCTATAGGGTGCATGCACTTGCCAGAAAGACAGACAGA
GAGATAAAAAGCAAGAAATCACCCTCCAGGAGTGATGGCCATGCTGCAATCCATTCTCCT
CTCTGGGATCTTGGGCACGCTCGCATATGCGCCCGGCGGGAGTTTAAGCCACTGGGTCCG
GGACTTGAACCACGGCCGGTTACATGGGAGTTGAGCGACATAGCCATTACACTAACTGCT
GGTCCCTGTTTGACTGTTCTAACACTGGTTTTGTACAGTAGAAGCGAAAACTAGGCCCCC
TAAATACAAGTGGTCATATTTTTGACCAAGGAAGGAAAACTTACAGCTTTCTCACTTCTT
GTGTTAATACATTTTTCTTTTCTATTCTAATGTAGATGATGGTGGCTATTCCATGAATTT
TAACATGAGTTCTTCCAGGGGACCACTTCCAGTAAAAAGAGGGCCACCGCCACGAAGTGG
GGGTCCTCCTCCTAAAAGATCAGCCCCATCAGGACCAGTTCGCAGCAGCAGTGGAATGGG
AGGAAGAGGTAAATAATTCTCTGTATAATGTAATCTGTGCTATCACCATAACACAAGGAA
TCGAGAGCTGAATTCTAAGAAACTGTAAAATTTGACTCATAGACTCTAGGTAATCTCATG
CACTTGAGCAGTAGGAAGAATTTAGATGTGAATGTGATATAAAAGTGTTGATCAAGCTGC
TTGTTGAGTTAGAATCACTACTTTTCATAGCCTGATGTAGGCTTGCCTGTTGACTTTTTC
TTTGGCTGTGTTTTAAAAATTTTATTGTTTTTCCTTAAGCCCCTGTATCACGTGGAAGAG
ATAGTTATGGAGGCCCACCTCGAAGGGAGCCCTTGCCCTCTCGTAGAGATGTTTATTTGT
CCCCAAGAGATGATGGATATTCTACAAAAGACAGGTAACAGAAAAGTGCAACTTTTAACT
ATATGGTTGAAGGTGAACTCATCAAAGGCATGAATGAACCAAATTATTTTTGTTTCTGTA
GCTATTCAAGCAGAGATTACCCAAGTTCTCGTGATACAAGAGATTATGCACCACCACCAA
GAGATTATACTTACCGTGATTATGGTCATTCCAGTTCACGTGATGACTATCCATCAAGAG
GCTATAGGTAAGTGACTGCTTCCATGGCTTGCTTGTCAAAAGAAAAAAGTTGCTCTAAAA
CTCGATGATCTGATACTTAGAGGTTTTTCTTTCTTTAGTGACAGAGATGGTTATGGTCGT
GATCGTGATTATTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCATATGAGAGTTAT
GGTAAGATACTGGTTAAGGATCTTGATTATCACCAGCTTGAGTTTTTAGGTTCATGAAGC
CAGTTTATTAGGCTGCGTGGTGCTTGCTTTAAAGGGATGTTTGCTTGCTTTTAAAGGGGT
AACTTTATCAGCTGGGCTTTTCCTAGTTTTGTGAGGGGCTTTTGTTTTTTCTAAGTTTTT
TTTTGAGGCTGTTTGCTTGCTTTGGAGGGATTTTGCTTGCTTAAATTGGCAGCCTTATGT
GTTTTCCCCCAACAGTGAAATACAATTTAAAAGTTTTATTAACAAGATCAAATTGTTTAC
CATTGCATATGAAGAAAGTCTACAGTTCAAATGCACTTATCACTGAAGAGCTGATGTCTA
CTATGAAATAACAGCTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
ATGGTGGCTATTCCATGAATTTTAACATGAGTTCTTCCAGGTGGACCACTTCCAGTAAAA
AGAGGGCCACCACCACGAAGTGTGGGGTCCTCCTCCTAAAAGATCAGCCCCATCAGGACC
AGTTCACAGCAGTAGTGGAATGGGAGGAAGAGCCCCTGTATCACGTGGAAGAGATAGTTA
TGGAGGCCCACCTTGAAGGGAGCCCTTGCCCTCTCGTAGAGATATTTGTCCCCAAGAGAT
GATGGATATTCTACAAAAGACAGCTACTCAAGCAGAGGTTACCCAAGTTCTCGTGATACA
AGAGATTATGCACCACCACCAAGGGATGATACTTACCGTGATTATGGTCATTCCAGTTCA
TGTGATGACTATCCATCAAGAGGCTATAGTGACAGAGATGGTTACGGTCGTGATTGTGAT
TATTCATCCAAGTGGAGGTTCCTACAGAGATTCACATGAGAGTTATGGTAACTCACGTAG
TGCTCCACCTACACGAGGGCCCCCACCATCTTATGGTGGAAGCAGTCGCTATGATGATTA
CAACAGCTCACGTGACGGATATGGTGGAAGTCGAGACAGTTACTCAAGCAACCGAAGTGA
TCTCTACTCAAGTGGTCGTGATCGGGTTGGCAGACAAGAAAGAGGGCTTCCCCCTTCTAT
GGAAAGGGGGTACCCTCCTCCACGTGATTCCTACAGCAGTTCAAGCCGCGGAGCACCAAG
AGGTGGTGGCCGTGGAGGAAGCCGATCTGATAGAGGGGGAGGCAGAAACAGATACTAGAA
ACAAACAAAACTTTGGACCAAAATCCCTGTTCAAAGAAACAAACAAAGTGGAAACTATTC
TGTCATAACTACCCAAGGACTACTAAAAGGAAAATTGTGTTACCTTTTTTAAATTTCCTG
TTAAGTTTCCCTCCATAATTTTCATGTTCTTGTGAGGAAAAAAAGTAAAACATGTTTAAT
TTTATTTGATTTTATGACATTGCTTCCAACAAGCAAATGTTAAATGTGTAAGACTTGACT
TGTTGTACTAGTGTTGTAATTTTCCAAGTGTCCCTAAAGGCCACTTCCTATCATTTTTCC
CAGTAAATGAGGCAAGCAGTTCTAAGATCTTCCACAAACATCTAGCCATCTAAAATGGAG
AGATGAATCATTCTACCTATACAAACAAGCTAGCTGTTAGAGGGTGGTCGGGGTATGCTA
CTCATAGGATTTCAGGGTGTCTTCAAACTGAAATCTCAATGTTCTCAGTAAGAAAAACCT
GAGGTCAGATGCCTATGTAAGGAAAGTGCTATTCACCCAGTAAACCCAAAACAGATGGAT
AATGCTGGCCATATTTTGCCTTTCTGACATTTCCTTGGGAATCTGCAAGAACCTCCCCTT
TCCCTTCCCCCAGTAAGACCATTTAAGTGTGTGTTAAACAACTACAGAATACTAAATAAA
AAGTTTGGCCAAAACCAACCATGAAGCTGCAAACGATGCTTGCTCTTACTGTTTCAAATT
TTTGCAACTCTGTAGTGTCTCACTTTTAAAGGAACAGCTTGATTGCAAAGGAGAAAATAG
ATAAGCAATGAAGTTATCTCCAACTTCCTAAAGGCTTATGACTTCTAAAAAGTGAATCTA
TCAGCATTCCACATCAGATTTAAAGCATCAAATGCCTGTGAAACAGCAAAGATGGTAAGC
AAAGCAAACTAGTTTTTTCGTCTAAGTCGAAATTGAACACTTACCTTCCTCATAGTACAG
TGAAACATACTGTACCTCATGGCAATGGAAATGCCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 1309..1415, 2175..2294, 2297..2338, 2340..2346, 3095..3247, 3519..3633, 3721..3846, 3938..4020, 4967..5277
1001..1109, 1309..1415, 2175..2294, 2297..2338, 2340..2346, 3095..3247, 3519..3633, 3721..3846, 3938..4020, 4967..5274
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved