Tupaia_belangeri Locus ENSTBEG00000006548
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000006548
Tupaia_belangeri
ENSTBEG00000006548
scaffold_146588
SNORA21
1129..1263
8147
ACCGTAGTTCGACTTAGACCGGGTGGCTGACTTTCTTTTTTTCTCTCTATCGCTGTCTT
CCTCTAGTGAATAAATAATAGGTAATTATTTTCTTTTAAAAAAAATCGTACCCAATTCTA
ATGAAACTGTTTACTACTCACTCAGCCCTGTTCCTTGGCGGTCCCTACGCAACGCGAAAC
GAATTTTAATTATTTCTGAATCATTTGCGTCCACAGAAGTGCCTGGCACGCACATACTAA
GTAATCAAAAGAGGTTGATGTGTAAACTAACCAGTCAATGTCCTCAACTATAAATATTTT
CGAGCTCGCAGGGAGGAGACTCCGTCCTCCTTTCATTTCTTCAAACACTTCCCGTCACGG
CTCACTCGGCAGCGAGGGATTGAGCCGACGTCCTGGACTCATTACGTCATAAAACAGCGT
CCTGGGAAAGGAGCCGGATTTAACAAAGTCTCGGTCACGTGACCAGAGTGGGCGGAGCTC
CTAAGGTCATATCCCAGTGTTCTTTGTACGTACTTCCTTTCTGTCTTTTTCCGGCGTTCA
AGATGTCGAAGCGAGGTGAGGCTTTAGGCTTTAAGGGTATCCTCCGCCATCTGTCGCGCG
GCGGCTTTCGGCCTCGCCGGGAGTGGCATCCCTGGGCAACTGGGAGTTGAGCTGGCGGGA
TCCCCACGCCATTTTAGACCGAGTCGAGCGAGGTCACTCCACGAATATCTGATGTGGTTG
GAGATGGGCCTGTGCGGTCTCCCACCTTGCAGAAGGAACTGCTTGTTGTAAAAGTTGGAG
TCGTTCAAGCCCCTTAATGTCGACATACAGATGGTAATAGTGAGGCGTCGGCTGTTTTCC
GTGAGGACCGGGTGGCGCGCGGAGAGGGTTTAAGTGGAATTCTAGAGGAAAAGAAATGTG
TGGTCTTCCGAAGCACGTTCGACGAGCTTACGGGTTGAGAGTGTTGAGGAGAACCCCGAG
TCGTGTCTAGACAGTGCTTTCTCAATCCCGTTTACCTTTTCTTTCTACCCGCAGGACGTG
GCGGGTCCTCCGGGGCAAAGTTCCGGATTTCCCTGGGTCTTCCAGTAGGCGCTGTGATCA
ACTGTGCTGACAATACAGGTGAAGCCTTTGACTACTGTCTGCTACACTCCCCTTTTTAAA
AGCACTCAGTGGGCCTTTGCAAATGACCCACTGAGCCGTCAAGAAAGGGCAGAGTAAAAA
CACCACTTTTGGGTGAAGTGGCAGCGTGTTGTGTTGTTTTGCTTCAATCCGTGGTGTGAC
AAGGTGTTCTACCTTGGCATTTAGCTGGCCAGTGTGCAGAGGGAGACGCTTTGGAAATGT
TTAGAAAATGTTGCATCCCTGGAATGGCTAAGTAAGTTCTCGCCCCCCAAAAATGTGGTT
TTGATTTTCATCCTTACATAGGAGCCAAAAATCTGTATATCATCTTCTGTGAAGGGGATC
AAGGGACGGCTGAACAGGCTTCCTGCTGCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGCTAGACCAGCTGAGATCACGGCTTTTTTTAAAAAAAAAAGAATTAT
GGTATTCATTCATTTATTATTATTATTATTATTATTATTATTATTATTTTATTTGAACAG
AGGGAGGCAGAGAGAGAGTGAGAAAGCAAGCCACCAGGTCTATGACTTGAACTGTGGTCA
GCCATGTGGGAGTGTCCAGCATCTTAACCACCACACCACTTGCTTGTTCCCGAAATCACA
GCTTTAATATTTGTTATCTGGGGCTGGCTGGTGGTGTGGTGATTATGGGCACTAGACTCC
CACATGGCCAACAATGATTTGAGTCCTGGATCTGGTGGCTTTCTCTCTCTGTCCCTCTCT
GATCAAATTAAATAAAGTAAAATACTTCTTAAAAAGATTTATGTCATCCTGGGTGAGTTC
GTTTTTTGTTTGTTTTATTTTTATTTTTGTTTTGCTATATAGGGCTTGTGAGCTCACCTG
AGAGAGGCAGGTGAGAAATTACAGAAAGTGAGATGGCCATACTGCAATCCCTTCTCCATT
CTTCTCTTGGTGATTTTGGGTGTGCATGTGCACACACCCCTTCCCTCCCCCCAGCCTGAG
TTTTAAGCTGCTGTGTCCAGGATTCAAACTGGGGTCGACTCTGCGGGAGTCCAGCAATGT
AACTATCACACCATCTGCTGGTCCCTGGAATTACTGCCTTGAAAGGAAACACTTTCTAGG
AGGTTAGGAGACCCCGGTGATAACCGAGTATGTAGAGCATCACATGCTAGCAAGCCCTGC
ACTTGGCAAGCACAGAATGCCAGGTGGTGCTTTAAGGTAGGTTCGTTCTTTCTTTCTTTT
TTTTTTTAAGAATTAGTCTATTTAACAATATTTACTTTTTTAAATTTATTCATTCATTTA
TTTTAATTTGACAAGTGAGAGACACAGAGAGAAAGAGGGAAAGTGAGAAAGCAAGCCTCT
AGGTCCGGTACTCAAACCATGGTCAGCCATGGAGGAGCATCCAGCACCTTTACCACCACG
CCACCTGCTGGTCAATATTTACTTATTTTAATTTGGTCAGAGAGAGAGCAATAAAGTGAG
AAAGCAAGCTGCCAGGTCCAGGACTTGAACCACAGTAGGCCATGTGGAATCCAGCACCCT
TAACCATGACGCCACCTGCTGACCCCAAGGCAGGTTCTTATAGACGATACTAACTCAAGA
TTGTGGACCTTGGGGCCAGCAGATAAGTAGTAGTTATGTTGTTGAACTAACACACGACCA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTCACCTTCCCTCTCTCTGTCTGTCTCTGGTGAGCACACCAAGAACCTGCCTG
CTGCTTAATCACAGGCTGCCCTCTGAAGTCTTATCACTGGGTGTATGAATTAACAGCCAA
GGCATTAGAGCACTTCTCACTAGTAATGATCTGTCTTACTTTAGCTATTCAGTACTCTTT
TTTTGGGGGGGAGAAGTTTTTGCTATAGGGCTCGTGTCCTCGCCAGAAAGACAGAGAGAT
AGACAGCAAGAAATCACCTCCCTGGGGGATGGCCATGCCTCAATCCCTTCTCCACTCTCG
TCTTGTCAGGATCTTGGGCACACACACACCCAGTGTGAGTTCAAGCAAGCTACTGGGTTT
AGGACTCAAACCGCGGTCAATACATAGGAGTCCAGTGACATAGGCATTACTCTAACTGCT
GGTCCCGAATTATTTTAATTTTAAAATACATTTACTTTAATTTTGATGGGGTGGGAGTAA
CAAAGCAAGCCACCAGGTTCAGAACTCAAACTGATTGGCCGTATGGGAGTGTCCAGTGCC
TTAACTCCCACGCTACCTGCTGGCCCCTCACTGAACTTTTAAAAATATATATTTCATTTA
TTTGTTTATTTAGAGAGATTTTTGCTATAGGGCGTATGCACTCACTGGAGAGACAGATAG
CAGGAAATAACCTCCCAGGGGGAAGGGCCACACTGTGATCCCTTCTCCATTCTTCTCCTG
GTATCTTGGGCATGAACGCCTGGTGTGAGTTTGAAGCCACCAGGTCTAGGACTCGAACAG
TAGTCAACCATGTGGGAGTCCAGCAACATAACCACCATGCCATTTTTAAATTTATTATTT
TGTTTGCTATGGTAAGCATGCATTCACCAAAGAGAGGCAAACAGAGAAAGAGCAAGAAGG
AAAGTGAGAAAGCAGTCCACCAGGTCTGGGACTTGAAGCATGGTTAGCCATGTGGGAGTC
CAGCATCTTAATCACTGCACCACCTGCCAGCCCCTTACTTGTTTTAAGAGAGCTTTATGG
TATAGGGCATATGTGCTTACTAGAGAGAGAGGGCAACAACGAGAAATAATCCCCCAAGGA
GGTGGTCACACTACATTCCCTTCTCCATTCTCCTTTCAGCATTTTGGGCACACATGCATA
TTGGCCTGGCATGGGTTTCAAGCCACTGGGTCTTGGGACTCAAACCATAGTCAACTATGT
GGAAGTCCAGCAACATAACCATTATGCCATCTGCTTGTCCCTATTTCATTTTATTAAGTT
CACTATAGGGTATGTGTATTCACCAGAGAGAAAAAGAGGAAAGTGAGAAAGCAAGCTACC
AGGTCTGGGACTCGAACTGTGGTTGGCCATGTGGGAATCTGGTGCCTAAAGTACCACACT
ATGTGTTGGCAGTGCACCTTAATTCAGTGGCTGAACTTTTCCTCCTGGGCATCTTAGCCT
GTCCCTCCAGCTGGACGTCTTGCTCTCTTGGAGAAGTCTTAGCCATTCCTTTGTCTTCCA
GAATGAGTGTGATGTGATGAGTTTGTTATCCTGTGTGCCTGCATCCACCCTGTCACACAC
CCCCCTCTCAGTAGCTTGTAGCCTTTGACCAAACATTTTTGTTCACCTTAGAATACCCAC
TTGGGGGCTTGGTAGCACTGGTGGTGATTACGCATCAATGAATCCATGTGTTAACTGGGA
TGTACCCTCTCTTCTTAGAACACTCCCTGAGTCTGACTAGTGGCCTAGGGAGCTGTCAGT
GAAGAGCATAGCAAAGGGCCATTACTTTATATGGCAGCAGGGTGGACTGTTGGTCTTACT
GGTAGAAAAGACCAGACAACATCATCATCATTATTTTGGAGAGGTTTTTGCTATAGGGCG
TGTGTGCTTGCCAGACAGAGCAGAAAGCAAGAAATCACCCCCAAGGGGGGATGGCCACGC
CGTAATTCCTTCTCCATTCTCTCAGGATCTTGGGCACATATGCACAGGCGTCCAGTGTGA
ATTTTAAGTCACTGGGTCCAGGACTCAAACCGCAGTCGACTACATGGGAGTCCAGCGACA
TAGCCATTATGCTAACTGCTGGTCCCACAACATTATTATTTTTAAATTTTTGCTATAAGG
CAGAGAAAGAGTACATGCCACCAGGTCCAGGACTTGAATTTTCTACTAATGCCATCTTTG
GTCCTTGTTTCTGCTTAAATGAATATGTCCCTTTACCTGGTGCTGATATTTAACAAGTAC
GGAATGTGAAAAGGGGGCAGGACTAGTTTAGGATTTGTGGCCTTACTACTTATTGCACGA
ATGAGAAATAAATGGTTTATGAGTAGATGGGATCCTCTTAGTTAATAATTACTGCTTCTC
AGTGTGCCCCATTGTTAACTTGATCATGTGCTGCCTACTTAACAGATTTGTGTAGGGCTT
GTGTCAAGGATTCTCAGGCTCACTGTCCTGTGTTTCTGGTGTTTGCACCTTGAATGTGGA
ACTGTAACTGTTACCTCTGCTACTCCAAAAAGATGAACTTGCTCAAGGTTTCCAAGCTAG
TATCAGTCAAGATTTTAACCCAGGTGTGTCTGGCTCAAATCATTGTTTTCAAGCATTACT
GTGTGGTGATGCTTCACGTTGAAGGTGTGAAGTGTCCTTTCACTTCAGTGTAGGGTAGCT
GGGAAACAGTTCATCCATAAATTTAGAGAGCCAGCTCTTAGCCTGGTGGGCTAGGGAGCA
GATCCCATGTGGCCCAGCCAAGGTTCTAATGCCTTCGTTGCCCTGCCCAGAAAAGGGCAT
GGGTCTCGAGCCGTTTTTTTTTAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGGACCAGCAG
ATGGCATAAATGGTTACATTCGCTGGCCTCCCATGTAGTCAAATCACGGTTCAAGTCCCC
AGACACTGGGTGGCTTAAAAATGCACACCGGGTGTGTGTGTGTGTGTGTGTGTCTAAAAT
CCTGAGGGGAGACTGGAGAAGAGATTGTATCATGGTCATCCCTCCTGGGAGACTCTCGGT
CTCCCTGGCAAGCATACATGCCCTACAGCAAAATTTCTCTAAGAAAAAAAATGTGGGAAT
CCAGCACCCCTATCCACCACACCACCTGCTGGCCCCTGGCCTTTCATGTTTTATGTCTTT
TGCAAAAATGAACTTGTCTGCTTTTTCCTGTTTTGTCGCAAATAACTTCCACTTACACAG
TTACAGACATAGAAATCACGTTCAGTGGTTGAAGAGGATTTCATTATTTGCATATGCAGG
TATTGGGCAAGTTCCAAGTTTTTGCTCTATTAAAACAATATACATGCTCTATATTAGAAA
AGCGTGGGTAAGGTGGAATGGTCATGGTCTCTGGGACATAATTCAGTTGGAGCTCAAAGA
TTGTATATATGCACATTAGCAGTAACACATTTTATTTGGGTAAATTGTAGGTGAGCTAAT
TCTTTTTAAGTACAGATTTATGCTTGTAAGAAAATGCTGTCAGTTTTGACTTTAGTGTTT
GTATTGTCTCTCACACTTGTTTTTAGAAAGTGAAAAGTTAATGAGTATACGTTCTGTCCA
GGGGTTCAAACTGCTTTTATGGTAGCACTGAGACTTGCCAGACACATGATGACTGCTTTC
CTCTTTTTCCCTTAGTGCATCCAGCAGTGGTAATTCGACAACGAAAGTCATACCGGAGAA
AAGATGGCGTATTTCTTTATTTTGAAGATAATGCAGGGGTCATAGTAAACAATAAAGGTG
AAATGAAAGGTAAGAAAGCAATCCAGGGACCAGTGTTGCAGCAGTAAAATGTGATGCCCT
CTTCAGATGGTGCCGCGTGGGATGGCTCCTGGTCCAAATTGGAAGGCCTCCCTGAGTATA
TCTGACCAAGATCAGGGCTGGCATGTGATGAAAACAGGTGGTCTGTAGACACATGCAGAA
ACGCTTCTGTAAGCTACCCTAGCAGGGCTGTTAAGATCTACATATGAAAGCAGTATCTGC
CTGCTGTCAATGGTTATCTTCCTGTTGTTGATACCCAATGCCCAAGATATAGTATCTGCC
TAATCAGACTGTCCCCCAAAAAAGATCAGAGACATTTTATGGCACCAGTCATTTTCCTGT
CTTAAGACGACTTACATAAAAAAACAACTGGCTTTGCATCCTGATTCCTCTTCCCCTCTT
CTCTTTGCATTTCACTTCCTTCTTCCCCGTTCCCTTTGCATCCCATTTTCACATTCCCTA
ATTTTCTGCAACAATTAAAAAAGTAACGATTAATAGCAGACAAATACTGGTTTCATATGT
AAATGTTTCTCAATAGCCCTATTAAAATAAATTATCAAAGCACATTTCTGGCAGGTGGCA
CTGTGGTTAAGGTGCTGGACACTTCCACATGGCTCACTGTGGTTCAAGTCCTGGACCTGG
TGGCTGGCTTTCTCACTTTCTCTTTGTTTCTGGTCAAATTAAAATGAATGAATGAGTGAA
TAAAGTTAAATAATTCTTTTTTAAAAAAAAGGCTTCTGTATGTGTCTAAAAGTCACGTGG
TTTCAAACTGCTCTCCACAGTGGAGGGTTTAACATTACATCAGGACCATCTTGGATTTTT
TTGTTTGTTTTGGTTGGTTTAGGTTTTTATTTTTGCCATAGGGTGTGTGTTCTCACCAAA
GAGAGAGAAAGTGACCAGCAGTTGGCGTAATGGCTATGTCGCTGGACTCCCATGTAGTTG
ACCACAGTTCGAGTCCTAGACTCTGTGGCAAAGAAAGTGACTAGTCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 1401..1423, 1425..1469, 1472..1532, 7035..7147
1001..1097, 1401..1423, 1425..1469, 1472..1532, 7035..7147
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved