Tupaia_belangeri Locus CSDA
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri CSDA
Tupaia_belangeri
CSDA
scaffold_9049
SNORA42
11206..11337
24682
TTCCAAAGGCAGGTGGTGCTCTTCAGACTGGGGATAATGTTTACGGGGCAACCGGATCC
TTTGCACTGCCCCATTCTAGAGGCTCAGATGCTTAAGCTTTCACCCACTGAGGCCACCGG
AGCAGAAAGTAGGATGTGGAACCATTTAGCATTCGTCAAACATGTCACTAAATACATATT
AACAACTCGTTATATGTTGCGTTTAAATTGGTGTAAATTTTGAATTTACAGTAATCCTTT
GAGGGCCGGACTTCCATCTCTTCACCTGTGGGTTATAGATAAAATTATCCATAAATTATC
TTTCAAGAGTTAGTTGCCAAAATAGTCTTAAGGTTTTGTTATTCCAGTTACTTAATTGTT
GTACCAGCTTCTGGAGCTCGCTACGTGTCGGAACGAATAACCCGTGAAAGACTGAAAAAC
AAGTGTTTGAGTGAGGCGCAGCCTAGGTCGGATGCCTTATTTCACCTGGCCTAAAAGTCA
GTTTAGGGGACCACGAGTCCTGAGAGAGAGTGCCCCTCGGCCCCACTCCCACAGGGACCG
CAGCGCGGGCTCCGAAAACTCCGGCTGCCTCCAGACCTCCGGTTTACCCTCTCCTGCCCA
CGCTCTCCGGCTCGGCCCGCGCTCCAGTCGCCGGCGCCCGGCGGAGCGGGAAGAGCACCC
GGCGCCTTTAAATGCTAATGAGGCAGATGCCCAACTCGGGAGCCAAGTTTCCCCACCCTC
TTCCCTCGCCCGCCCTTCCCTCCCCGGCCGGTGCGCCGCCTAGAAAAACTTGTGCGGGGC
CATTTTTGGGGCAGTAAGATCCAGAGAGGAGCCCAAGAGCAAGCGCGCAGCCCGAGAGCT
CGAGCCGCCTCCGCCGCGAGACCCCACCTCGGCCGCCGCCGCTGCGCCGCGAGATCCGCA
CCGGCCTCCCTGAGAGCGAGCCCCGGCCGCCGCGACCACCAGCTGCGCAACCGCCGACAT
ACCGCCACCGAGGTGCCCGAGTGAGAGCAGAGTAAGGCGGCATGAGCGAGGCGGGCGAGG
CCACCACCACAACCACTCTACCGAAGCTCCGGTGAAAGTGGCTCTGTGCTCTTCTAGTAC
CCGCACCAATAACCTGTCGGATGCGGAGCGCCTCAAGGCCGCACTCCTAGGCCCGCGGAC
TTCGTGGAGGGAATCCCGGATGTGAATCGGTCCAGGCACCAAGGGTACCTGGACCACCGT
CTCTCTAGCCACCGAAGTTCGGCAAATCTTCTAGAAAAAGAGTTCTCATTGAGTTTGTCT
CGGGTTGATAGGGCAAGGGCCTGCTTCTATCCAAGGGCTGCGAAACGTATGAGTGCTGAT
ATATGGAGTTACTTTAATATGCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCGGGGTCGTAAATTCTGTCGCCCAGGCAAGGCGGCTGTCGCGCATTGCTGTGTTG
AGAATGCCTGGTCCGTAGAGCAGGAGGAGAGGCAGCGAGGTGGCAGAGAGGACTCCAGAG
CAGGGATGGTTGTGGATGGAGGAGAGGGGCAGACACGTGGGCCCTGGACTTGGGATCCAT
TGCTTAAGGGGCTAGGTAAGGAGAGGATTCTCTTTGGGAAGAGTGTGGCTGTGGAAAGAG
ACGGGGAGGGGGAAGTGGGAAGGCTTCTTGCCAGGAAGGCTCAGGTGTCTGTCCCTGACG
CCCTTCCCACATGGGCATGGGAAAGACGCCATGCTTCTGTCGGCCACATGCCGGCTAAGG
CGTGTTGCAATCCTCGCCGGGAAACTTGGGTCCTGGTCCCACGTTCTCCTCCCTCTCGCT
ATGCCCATTGCTGCAAAGAGCCACCCCGTGGCTACCAATCGCTGCACGCTCGCCTCTTCC
TGGACTCTGGGAACGCACGTGGTGTAGCAGCTGAAAAAACTTCGTCGGAAGTGGGGGTAT
GACGTTAGTTCAAAACATCGTTACCTTGGGACTTGAAACTTAGGAAGGGGAACGGGAAGA
TGAGAGGTTCAGATTTTGGGAGCGGAGGATCAGAAAGGGTTTCTGTGTTGGTTGTTGGTT
TTGTCGCATATTCCACAGGCCTCATCCCCTTCAAGTGACGCCCTTCATGAGGCCTTCCAC
AGGCTGCAAAGCAGGTGGGCGGTGGAAGCTCCCTAGAGGGCTTGTTCACATGTATGTCAT
CCATCCACTCCCAACCGGAAGGCTAACGCATGCCGTTTTCACTGTTTTGGGGTGGGGCAT
GTTGTCTGATCTTTCTGAGCCTTGCCTCCCTTTTAGGAAAGAAAGTTAAGGGAATAATTG
AAGAAACGTTGACACCATTCGATGTTCAGAGAAGCGCTGTTTTCTTGTTTGGGCTTTAAC
TCAGTTTCTGCCAAACAGCATGCTGAATGTAACCTGTGTAGGTGAAACAACACAGTAACC
CCCTTTCTGCCAGACTATAAAAGTTGCTTAAATCTAGTCAGTATGGTATCATGATGTAGT
TTCAACAAACGTTCCTTGCCAATCGTCTGAGACCTCATGTTATCCAAGGCCATCTTAATA
ATACCTATTTTGGCATAAAGAACCTCTTGTAGTTTTCTTTTCACTTGATCCATGTACCCT
TTTTGGATAGGAAAGCAGACATTATCTTTAAAGAGGAAGGGAACGGATGCATTAATGTTT
GTATCCTAATCACCGGCTGCTATTGTGCCTCTCCCAGAACCTACTGATGACTCCAAAGCC
TCTGTTTACCTTGCCTCTGTCTCACCAACTCTCCCAAAATGGACAGCCTTCTCCATGACA
CTTAGGACACTGTGGAGTATGTCTGGCCATCTCCTTTCCCTTTGCCAAGTAAACACATGG
ATGCCTGAAATGTGCTAGGCACAGCACTGACTGAAATGGATATCTGTTCTTGGATTCTTT
CATTCTCGTTTTTGCAAGTGGGCCGGGCCCTAACTTGGATTTATTGCACACAGCTCAGGG
AAAATATTTTCCATGAGTGAAATTATTATCTTCTTCTTCTTATTATTATTAAACTTAGAT
GTTTGTCCAAGGGGGCATGTGCTCACTGGGAGGAGACGGAATGGGAAAGGGCGTCCCCCA
GTGGGGTATACTGCAATCCCTCCTCAGAATTTTGGGCACACACACATACCTGGTATGTTT
CTCATTCCACCAGGTCTTGGGCTTGAACCTTGTGGTTGGCTGTGTGGGATCCAGTTTTCT
TAACCACTAGGGCCATGACTGGGCCCCACACTTTGCTTCTGGTGGACATTATGGAAGACT
TTACGGTTCTCCTTTGCCTCATCACTCTCCCTTTCACGGGTGTGTGTATGTGAAGTGAGT
TCATGGTATAAAGTAAGAAGTATGAATGAACTTTGTGTTGACCGTATGAAGTCTTTGGAA
ATATCTGTGGAATTAGTTTTTTTTAAATAATTGGAGAGTAAAAATAACCAGCCTCGATTG
CAGTTAGACTGGAGAATCATTTCTCATCTTTACCCCTATTAACAGTGTTAGCGTTCTAAT
CGACAGTGCTAGACAATAAAAAGTTTCCCTTCTTTGTATATTTTCCTAGGTCATCATTTT
GTGGCAAATGAGAAGAGACATAAAGAGCCTATCATTTGAAAAATTAAGTTAAAAACAGGG
ACCAGCAGATGGTGTAATGGTTGTTTTGCTGGACTCTCACGTGACCGACCATGGTTCGAG
TCCTGGACCTGGCGGCTTCAAACTTACACCAGGAGTGTGTGCATGCATGCCCCAAATCCC
AAGATGAGAATGAAGGAGTAGGGATGGGGTCATGACCATCCCTCCTGGGGGGGTGATTTC
TCACTTTCTTTCTCTCTGTCTCTCTCTCCAGGGAGCACAAGGGCCCTATAGCAAAAAAAA
AAAAAAAAAAAAAAACAAAAAAACAAGACACTCTCTGGGGGGAAAAAAAACTAGTTAAAA
ACATAATTTATCAGGCCTCTGTTTTGTGTACATTTGCATGAAAAAAACAGGTGCCTTCCT
CCTTTGCCCCGTTGCTCCAATCAGAATGACCTCAAACTAAAAATTCTGGGGGCTTGATCT
TTGCACTGGAGAAATCTTCATGGGATTGGAGCTGGATAGTGCTTCGTCAGTGTGAGCTGA
TTGACTTGGTTTGGAGACATAGTTTTGTTGCTTGTCTTTCTTACACAGGGAGCTAAAATG
CTTTCCCAAGCTGATCCATTTAACAGAACTCAGAATGAACTCTGCCACAACAGAGTTACT
ACTATTTTCTTTTAAATTTAAAAAGCAAAGCCAGTTGTGTTTATCCTTGGAAATGATAAA
CTTTGTAGTTCACGGAAAGGCGGCATAGATTAATGTTAATTGTTACTTTCCTTCTCTGCT
AAGCTTTTCTTTAAAACAGTTTTATCTATTGTCAAGTTTCCTGTTTCATTGAGTCTTGAT
AATTGTTTCATGTGTTTCCTGAATTTATCATAGGTATTTCCTAGATGTACTGGAGTTAAC
ATTCACAATTGATTCCAAGGGTCATATTTGAAATAATAGAGATAGGAATTTACACAGTAC
AAGTTGTATGAAGTTACAGTTTGTTTAGATTCCTTGAAAACTTGTGCTAAAATCTAGTGT
CGTAGAGGAATGATCCTGTCCACCATAGAAGGTAGAAACAATAATCAAGTTAAAGAATGA
GATATTTTAGAAAATGCTGTTTGATTCCCGCCAATTGTAGAGCGTAAACAATGAACCAGA
AGCCCACATTCATCACTGTGGTTTGAAAAGACCTGTTACATCATGTCTCAGGTATAGAGC
TAGGTTTTGAGACAGCATCAGTGCAATTATTACCCCTGACTCTTCTGATAGGCCCCCATT
TGGCAGTGAGTCTAGTTATTTTGTCTTTGTGGGTTGACTGTTAAACAAGGAGCTACTGTG
TTACTTATTAAAGTGTACCTTAATATTTCAGAGTGGGAAAGTGGTATGTTCCTGTTCTTC
ATCTACCTATCCTCCTTTCATTGTGACACCTTTGGCAGTAACAAACTTTTTCTGACTTAA
AACTTGGAACATTAGTGGCCAGATGGTAGTGCAGCAGAAAAACAATGACGTTTTGCAAGT
CTGACCCACATGGGAAGGTTCTGTGTTCTCCTCTAGAGACCTTCCAGAAAACAGTGAGAC
ACAAGTATGGCAGGCATACACGTGCACGTGATGGGGGTGGATAAAGTGTGGAAAGCAGGG
TCAAGACCCAGTTGGGTTGCCTTGTCTTTGTCTTTCTCTCATGGAAGAAATAAATTAATA
AACTAATCTTGAAGAACAACTTTTTCCTTGTAGCATGTTTCTCAATCTTAGTTATCGCAG
AGTGATGCAGACTTATGGCTACTCCTTACTTTATGGCTTGACGGAAAAATTTAATAAGGA
AAACTTTTTGATTTACTTTTCTGAAAAGTATTTCCTTATGATATCTTGTCCCATTTTCTT
AGTGTATTTTGGAATAAAGTGTTCAGTGATTTCCTCAGGTGTTTTAGGCTTTGGATAACA
AGACCTTAGTGATACTACCTTATCTCTTTGTAGATTAGATACTAATTTATTTGCTTAATC
CTATTTTAGCCACCAAAGTCCTTGGCACTGTCAAATGGTTCAACGTCAGAAATGGATATG
GATTTATAAATCGGTATGTGCTTATATATTTGCATGTTTTAAATTTATACTTATGTTGTG
ATATCAGTAGTTATGAATCCCTCATCATACTTTATTAATAGCTTATATAAATTGTAAGGT
TTCTAAGCACTGCAAATATTCTCATTTCTGAGCTACCAGTCATTAAATATTAATTAAAAC
ACATTTCTAGGATACTAAAAATAACTTTATGTTATAAAATCCAGTCATTAAAAGAAAAAA
AGGGAGGGGAAGGTAAAATCAGAAAAGGCGGGGGCCTTAGGATCAATGAGCCCATATCAA
TCAGTAACTTCTCAGATGGAGAAGTGGAGTCTTAGACTGATTAATCAACTCCCCTGAGGT
CATGCAACGAGTGAGTAATTGAGCTGGAACCTGGGTCTAGTGAATTCCTGGGTAGAAACT
AATGTTTTCTTTAGAAAACTATGGTGACTTCTCACTGTTTGGAATGAGAACACAATTATA
AGCTGTTGGGAATATTATGATGTTTTTATCTGCCCCTACCACCTTCTTAAAAAAAAAAAA
AATTCCTTCAAATTTCTTTCTTGTCTGTTTTGGCATGGGGTGAGGTGGAGGGGGCTGTTT
TAAGTTTCACTGTAAGGAGAGCCTAGTTCACAGCTGTGCCCTGTCCTTTTAACTGTCTTG
CTTTGCTTTTGCTGGGAGGAAAATCTAGGCTCTGATTACATACCATGTGATTCAGAAAGA
GGAAAGGGATGTTTCGGTGTGTTGAATCTGTGCACGTGGACCCAGGCACTGTAAGGTGGG
AATCTTGTAGTTAAATCTCTTCACACGGATTGATTCTAGGTTTCTGAACTGAGTTTGGAA
GATAAATGTTATGTTATGTTTTGAGGTCTTATTTTCTAAATTCTTATGATCTAAAGGCGA
CACGTGTCACCTTTTCTATCTAACCTTGTACCTTTAACTGAGCTCTTTGTCCTTCCAACA
GAAATGACACCAAAGAAGATGTATTTGTGCATCAGGTAAGAAGATTTATAAATGCTACAT
TTGCTGTGTGAGGGGAGGTGTGTAAAATCTGCAATTATCTCTTTTCTAAAAGGAAGTCCT
ATAAATTATTCTTGTACTGTAAACTGTGTTATATTTTGGAGTGAGAGCTCAATTCCACAT
TTTACGATTGGCAGGTAAGCTCTTCTGCCCCATCACGTTAACTGCTTTCCAGGGTTTTTC
TTTAGAAGTTGAATGAATAGTCTGTTAGACTACTTTTCTGTTTCCGTATTTGCATCCTTT
TTTGATGTTGTGGTTCCTGCTTAGTGTTTGGCTGGATCCAGATTACCTTTGGCCCTGTGG
TATCTGTTAAAGTTCCTCTACCGAAACAGCTCTCACTGAGAGGAAGAAGTGCAGAGAAGC
AGTTGGTTAGGGTTTATGTATCTAATACTTCCATTTGCAATGATCATCCTCACACCTGTT
GAAACGAGGGACATGTCTAGATCAAAAGACCCACATTCCCTTAGATTTGAAAAAAGCACA
AATAATGGGTAGCATACGAAACACGTGGGCTTCTCTGAAATGGCATCTCTGTCTTTACAT
TAACAGCCTAGGACATTATTTATTCTATTACTATGTATTCTGGACTTACTTTACAAAATA
GGTTAAGAAAAGAAATTCGTATCCTTATTCTTTTTGTGTATTTCATTTTCAACGAATTGC
CTGAAATGTGTGTGTGGTTCTTAGCATGTTACACAGCAGGTACTAATGCCAGTCCACCTA
ACCTGCAGGGCTATGTCGGGCAAATGGTTTTATGTGTTTCCTTACATTTAGGTTTGTGTG
TAGGTGGAGTGTAGGTGGTGGGAATTGCAGTAATGATATCTTAAAAAACAAAACAAAACT
CTCCTAGTTACGGTTTCAGTTGTATATTTCTCTATATTTCACTTGTACCTAGATCACTTG
AGTCGATTTCTTTTGTTATTCAGATAAATAACAGTGACTTTTCAAGTTGTAACAGACGGG
AAGGAAGTGTCACTTTACTACCTGGTGTTTAATAGGCCTTCTGGGGCAGGAACTCTGCAG
GGTGGCTGTAGAGTAAAGGACCGCACAAGTGTCTGTGCACAAGTGTCTGTGTCGGTGGCC
AGCTTTATTAGGCTGTGAGTGTGTGACCTGATTCCAGCCCCCATGAGGCTGTGTGATGAG
TCACCCCGATGTGTTGAGGCCTGCCCAGTTTAACAGGAAAAGGGAACGAGCCGGCAGGGA
GGGGCTGTTTCTGGATGGCGGACGTTCTGCTGCGTGCGCAGTGATCTGTCTGAGCTGCTT
TTTCCTCTGTGGGTGAGTTCTACCTATGCTCACTCTTTATTTATTTATTTTTTCCCTTCC
TTCCCTCCTACTCAGAGTAGGGGAAGGGCTGGATTACACATGCCTAATCGCTTTATAAAG
TAAGGTTGACCTAGTTCCATAGAAACTCACAGCCCCTTTAACTGTTTAAAGATACCAGCT
GAAGAAGTGGCAGTTCACTGCAAGAGGTAGTCTCCCCTCCATTGACTAAAAAACAGAGAG
GTCTAAGCAGACGTTTAGGTGCAGGTGTTTAGTGTAGAATAGCATCTCCATTAGCCTCTT
AATGTATTGACGGGCTGGTTGCTACCTACGTGGTGTGGTGGGGAAAAGTTGACTAAGTAG
CGTGGAGATGCAGCGCGGGCATTGCTGACAGGGACTCTCTCCTCCCACCCTCTCCTCGTG
ATTTCAGATAAATAAATCCCTGACCTGCCAGCCCCGTTTTTCCTTCTCTGTAAAATGGGA
GACTGCGGAAGAAATCAGATTATCACTGATATATTTTGATTCCTGAGGTCATGTTGTTTA
CTCTATCAAATATTTATCTACTTGACTTTTTTTTCCCGTTTTCTTTTATCATTATACCCG
CCACACATACACATTTTAATAATTCCTTTTGAAGTTGGCAGTTCCACTCGCTACAAAACC
CTGTACCTAAAATGCATGTGTGTATATCAGTGAGATCTCACAAAGACACTCCCCTCTGCT
GATGCAGTCTGAACCTCAGGCTCAGCCATTTTCTTTTTTTTTTTGGTGTGGGGGGGTAGG
TTTTTGCTATAGGGCGCATGCGCTCGCCAGACAGAGAGAGAAATAGAGACACAAAGCGAG
AAATCACCCTCCAGAGGGGATGGCCACGTCGCAGTCCCTTCTCCTCCATTTTCCTCTTGA
GATCTTGGGCACGCACGCACATGCGACTGGTGTGAGTTTAAACCACTGGGTCTGGGACTC
GAACCGCTGTCGACCATGTGGGAGTCCAGCAACAGAGCCATTATGCTAACTGCTGGTCCC
CCTATAGCCAGTGTTTTGATGTGATGAGGCGATAAGGCTATGAGAGAAGGTGCAGTAGCT
ACACGCTGCTGTTCAGTCCTATCAAGGTGAATTTTTAAATAGTGCATACAAGTCAAGAAA
GTAATGTGGAATAGTTTTTTAAGCTTTTTTTCCCCCCTATAGTCTAGGTGTACTCACCAG
AAAGAGAAGAGGTGAGAAATCACCCCCGGTGGGGGGATGGCCATACTGCAATCTCTTCTC
TCAGGATTTTGGTCACATACGCACACCTGCCCACGTGTTTTTCAAGCCGCTGGGTCTAGA
CTCAAAACATGAAGTTGGCTGTGTGGGAACCAATCCCCCAACCACTACAACAGTAAAGTT
TTGTAGTGTGTTTTTAAATCGGTTATAAGTCAGGGCCAGCAGGTGGCATGGTGGTTAAGG
CGCTGGACTCACACATGGCTGACCACAGTTTGAACCCTGGGCCTGGCAGCTTGAGAATCA
CAATAGGTATGTGTGCCCAAAAACCCAAGTGGAGATTGGAGGAGAAGGGATTATGGTGTG
GCCATCCCCCCGGGCGGTGATTTCTCTCTTTTTCATCTCTGTCTCAAGCAAGTGCCTGCA
GCAGAAAGACCTAGGGGGATAAAAAAGAATATGTCAACGGTTTTTTCTTTTGTTTTCAAG
TTGACTTTAGTAAATTTGAATGCAATGAAATCTGGCACATATTGAGATATGTTTCAAAAG
AATTTTCTGTTTTCTTGACAGACTGCCATCAAGAAGAATAACCCACGGAAATACCTGCGC
AGTGTAGGAGATGGAGAAACTGTGGAGTTTGATGTGGTTGAAGGAGAGAAGGTGAGAGGA
AGCGTGGTTGGGTATTAAAGTGTACTGACTCACAGTTTTGTTGAAGAATCAATGATCTGT
TAGACTCTTATAAATGAACATTATGAGAATAAAGCTTTGTCAACTGATTCGTGAGGACCT
TCGTTTACAAATAATATACAGTAAGTAATATACAGTAGTCCCAGCCCTGAAGCATAGCAG
TTAAGCCATGGCTCATATGGACAACCGTGGTTTGAATACTGGCCCTAGCAGTTTGAAAAA
CATGCTGGACACATGTATGTGTGTTTGCCCCAAATCTTGACACATAAGAGAAATGGCAGA
AAAAGGATTGTGGCGTGGTCATGCCACATTGGGAAGTTTGCTCCCCCTCACCCTCTGGTG
AGCACACATACCCTACATACCCTCTAATATTATATTAAAAAAGTTATACACAGTAAGGAA
TATTTTAATCTCAGTAAAAGAAGACTCAAGTTGAATATCATCATGTTTTGTCTTCAGCTT
TGATTTTGGAAAGCTGAAGCCATCTGGATAGGTTGTATAACAGCTTTGTTGAGATGAACT
CAGTGCAAAAAGCTGATGGATATCTACAGATTGAAGAATATCTACAGAACTTTTTTAAAC
TGTTGTGTATTTAATTCTGGTATCAGAAATGTTATTTATGCTTTGTGTTTAGTCAGCAGT
CTTACTGTGGATATCAGTAAAACAACTGAGGCTAAGACTGACAACATTTTAAAGCTGCAT
ATTGTACAATGGTCATGGCAGCAAAATGATAAACTAAGTAATTGACTAGCTCAGTCCCGT
GTGTACACTCTTTTCCATATGCATACACACCATTCCATTGTTCATATTAGGTGCTCTTGA
ACTGTTCCATTTTTACAGGAAAACATTTCATTTGATATAGAAAGGCAAGTGGTTGTCTTT
ACCAATGTAATTCCCAGGGTGTATTGCGAATCTCTTGGTGTTTCAAATCATCCTCTAGCA
AATGTTGCCTTGTAATGATCTCTGATATCCCATTTCCCACGCTTGCCAGATTAATTTTAC
TTCTGCATGTTTTTCAGAACTTGAGGTTTTACAAATTGACATGGTACACGCTTTTGGATT
TCCTTTATCTAATTTTTTTTTTTTTATAGATTTGAAGCATTATTTTGCCCGTATGTGAAT
AAGAACTCCTAAGTCTGTTTCAGAATAAAAGTGGCGGCCCTGTTACTAACAAGGACCCTT
TCTTCTGTTGCTACCCAGAGGGAGAGGTTTCATTCTCACTGAAAGCCCATGAGTAGGGAT
TCCCTTGTAATGTCATAGGGTAACAGGAATTAACAAGGTCTAGGATGATAACACTATCTC
AGTGCTTTTCTGTTGAGTCATATTCTTCCTGGTCTAACATTACCTCTCTTTTTTACAGTC
GTGTTGTGTTTACTAGTTTATGTTCTTTAAAATGGTATTACTGCATGCATGGGTTTGGAT
TTATGGCAGGTCCGTCCCCCTGGGCCTCTCATAGTGTCCCATGCTAGAGCAAACTGGCCC
CAAACCATTGCCCAGTCTCTGCCTGTGGGCTGCTGGCACTGAAAGGAGTTGCACAGGGAA
ATGGGGGTAGGAGGGAGAAAAGGAAAAAAGAAACAAAAAAGGTACTACTGTTGTTGAACT
TGGCCTAGCCAGATAAGAAGGCAGAGCATAGGCTGTGTGAGTAAACAGACCATACCCGTT
TAAATCGGGGCACTAGGCACCTTCTCACCTTGCTAAAAGTTGCATCTCTTTTCAAGATTA
CTATAGGGAATCTTAGTACATCTGCCAATCTCTGCCTACTCCAGGCTGTTTGGGGTTAAT
TATGCTTCTTTTTAATTCCAAGGCCTTTTGCTTATTTTCTTCTCTCAGGGTGCAGAAGCA
GCCAATGTGACTGGCCCAGATGGAGTTCCTGTAGAAGGCAGTCGATACGCCGCAGATCGG
CGCCGCTACAGACGTGGCTACTATGGCAGACGTCGTGGACCTCCCCGCAATGTACGTCCT
CTCTGGTACTCACCAGCGACTAAAAATCTTCACGTCTAAAATTAGGTGTATGTACTTAGA
GCAGAGAAGTGCCATATTTTCTCTTGGAGACAGAATAAGTCATTTTTTTTTCTAACCTTA
TTTTTGAGGGAGAACTTTGAGTGCACAGAATTTATCCATAGCCACTGGCCTCACTGGATA
CTTGGCGTTCAGAATTCAGAATTTTTATCAATCAGGCCATATCTGGCTGCAAAGTAACGG
ACGTAACTGTCCTATAAAGAAGACTCACTTGAAGTAGGTAGTGCCAAGGTTAACAGAGGC
TTTCTCTTCATTTGGCTCTTAGTATCTGGCCAGAACCTAGTATCTGGCATTCACTGGCAG
AGGGGAATGGTTTCCTTCACCTACTTAAACCTGTTGTTTATTCCTTGGCACTGACACTTT
TGACCTCTAAGGAAATCAGCTTTTGGTTGGTAAGAAAGAATGGGAGCTAGCTGGCGAATA
TGCAGTAAAAGTATTGGCCACAGAAGTATCAAGTGATTTATATCAATTGAGTAGCTGTTT
TATTTAGCCTAACAAACACAGTTTCCCATTATTTCAAAGAAGCAGTAAGAAATTCTTTGG
ATCTTTAGTTCTTCAGATGGGTCGAAATCCAAATGAAAGAAAACAGATCTGGCTAGAGCT
TTCTTAGGAGGCTCCATTTAAAGGAATTTTCTCAAGGCACCCAGAATGAATGCAGTTCCT
TTGTGAATATGAGCACTGTACTAGATTTGAGTCAGTTCTCGACCTTTAATTGAGTTAGAA
GCAGGGATAGAACTCGAGGTACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCATGATTTTTCTCTCTTTTTCTGTCGTGTCATACCCTGCTTGAATTTATTTCATGA
GAATCTTTAGAACTCTAATCTGTTTATTTTTATCTTTGCTTTACCTATTCTATTTTTGTT
TGTATTGCAGAGGATATGTGTGCTTGCCAGAAAAAGAGAGAACTCCTCCAATGGGATGCA
GTCACACCAAAATGCTTTTCCCTCCATTGCTCCCTGTCAGAATTTGGGAGACATACACAC
ATGTGCCTAGTGTGTGTTTCAAGCCTGTAGGGCCATGTGGGATCAATTTTCTCTTGAGCA
GCACATTACCACTGAGCCACAGAGCCCAGCTGTGAGTCCTGCCTTAGCATAGGTTTTTTT
TTTCTTTTTTTGAGAGGTTTTTGCTATAGGACGCTTGCGCTCGCCAGAAAGACAGAGAGA
CAGAAAGTGAGAAATCAGTCCCCAGGGGGGATGGCCATGTCACAATCCCTTCTCCTCCAT
TCTCCTCTAGGGATCTTGGGCACGCACGCACACGCGCCTGGCGTGAGTGTAAGCTGCCGA
GTCCAGGACTTGAACCATGGTCGACTACATGGGAATCCAGCGACATAGCCATTACTCTTA
ACTGCTAGTCCCAGCATAGGTTTTTTAAAGAGAGAATAGTTCTGTTTTTCTGAACTGAGA
CTAGTTGGGGCTTATCCTTTTTGGGAATTTAGTGCGTGTGGGCTTATCCTGGAGGAGTCT
AAAATATAACCCCCTTGCAAAGAAAGGAGTCATTTCATTTGCAATTTATTCCTTTTTGAA
AACTACAGTTATGTCCTATAGACACTGGCATGTGCGCATCCCTCTTAAAGTAGTATTTGA
AAGTAGATTTGTTCAGAGACATTTGGCTGTTTAATTTCCCAAAATATAAAATGGTAGTAT
ATAATACAGTAGTTTAAATATAAGAAAAAACATAAAAGTGAGTTGACAATTCCCTTTGTT
AACAAGTCTGTATTTAAAAATTGCTTATGTTTAATCTTATTCCTGTCTATTAAAGTAGGA
TTAAAAGTTTATTTGTAAACACAAAGGAAAGTCATTCTGTTGTCAGTGCTTCTCATACTT
TTTGGTTTTTGCACCTATTTATATGCTTAACATATTAAAGATACTAGAGCTCTTGTTTAT
ATATGTTTATGTCTATTGATACTTGTTGTATTAGTGATTAAAATAACTTTAAAATGTAAA
GTAACTCATTACACGTTAGTATAAATAACATTTTCTTATGAAAAGAAAACTATTAAATTG
AGTAGGAAGAGTGGTACATTTGTCCCTTGTGTTCACCTGGGATTGGTTCCATGACCACAA
ATGCCCAAAGCCAGGGGTGCTTGGCTCTTTCATAATAAATGGCATAGTGTTTGCATATTA
CCTGTGTACATCCTCCCATATACTGTAAGTCATTTCTCAATTATTTGTAATACCCAGTGC
AATGCAAGTGATTTGTAAACAGTTGTTATATTGTATTGTTTAGCAAATAACTACAGTTTT
TAAAGTCTGTACATGTGAAGTACAGATGCAGCCATCCTAGCCCAACTATAGGGTTGGCAG
AAAAGTCATGGCACATTTTTGCATAGAAAAACAAAAGTACGTCATGACTTTTCCAACCAC
CCAATACATAGTACAGGTCAGTAGCAGTACAACGTTTTTGACCCCCGGTTGGTTGAAGCT
GCATTACAGCACTGACACCGAGGGCTAATTGTATTGTTGCATGGTTTAATAGAAGATAGC
TGCATTCTGAGATCTGTTCCTCCAGTCTGCTGGGAGGCCACATGCCATTGCAACCCTTGG
AAGACCTCACCATCCACCCACAGGAGAATGACTGGGAGAGGCAGATAGCATCTCAGTAAC
ATTAGGAGAACACTTGACTGCACTCCTCCCCTCGAAGGTCTCAGAGATCCTGGCCTCCTT
TGAGAACTGCGTAGAAAGTATGCCTTTTAGGTCAGTTACGTTGCTAACATAAAATAATAT
TTTTTTTCTTGGTTTTGCCCAAGTGTATGGTAAATGTTGGGAGATACACAGTTGGTGGTG
CTGATTATTATAAGCCTTGTAGATCTCCTTTGGGTGGTTGGTCAACTGATATTCTCTACT
TCTAATTAGATGACAATTACGTTTATTACGGGGATTGATTGCTCTTGCTTCTTGCTGCTT
GGTATTTTGTCTGCACAGATCTACTTTAATTTTAATGTAGTTTAGCCCAGGTAATCACAT
GATAATCTGGGTTAAATGCATATTGCCTGTGTAATAGACGGGATCATTGCTTTGGGGAGA
TTTTTTTTTTTTCCTTTTGGTGACATTCATCCTAAATGGTATTCTTTGGTTCTTTCCTTG
CTGAAACTTCTTCTGAATCTCTGTTTCTTTGCTTCGCTAGTACGCTGGGGAGGAGGAGGA
GGAAGGGAGCGGCAGCAGTGAAGGATTTGACCCCCCTGCCACTGACGGGCAGTTCTCTGG
GGCCCGGAATCAGCTGCGCCGCCCCCAGTATCGCCCTCAGTACCGGCAGCGGCGGTTCCC
GCCTTACCACGTGGGACAGACCTTTGACCGTCGCTCACGGGTCTTTCCCCATCCCAGCAG
AATGCAGGTAAAAGTGCACCTGGGCCTTCTCTTCAGCAGTCCTCACCCTTCCATCCTTCT
CTGCCTCCTCTTCCTCTTCCTCCTCCTCCTCCAACATCAGCTGCCGGAAATAATACCTGG
CTTGTGGCTTCTCGGTGCTGTAAGAGCTGAGGCAAGGCCTTCAGTCTGCTTTTTCAGAGC
AGCCATTCTAGGAGCATTCTAGAAGTGCAACCCTGTGAGCCATGTATATAATAGGGGCTC
CTGGAAGGTAGGCGAAGTTTCCAGTTTATAGAAGAATGAAAGGGGAGGGGGCAGCAGGTG
GCATGGAAGTAAAGATTAAGGTGTGGGATTCTACATGGCCAACACCAAGGTTTGAGTGCC
AGACCCAGTGACTTGAAAACATGCCAGGCACGTGTGCATGCTTACTCAGAATCCTGAAAG
GAGAATGGAGAGAAAGGGATTGCAGCGTGGCCATTTCCCTTGGGGGTGGGAATGTGATTT
CTCATTTTCCCTCTCTGTTTCTCTGGGAAGTGCATGTGCTCTATAGCAAACTAAAGAAAA
AAACGAGAAAGAAAGCAGGGACAGATGGTATATAAGGACTTGAACTTCAGTCAAACAAAG
CCTGGATTTGAGTCCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGAGTTCTCAGACCTGGTGGTTTAAACTCATGCCGGGCACGTGTGCG
TGCGTGCCCAAGATCCCAAGAGGAGAATGGAGGAGAAGGATTGTGGCGTGACCATCCCCC
CTGGGGGGTGATTTCTCGCTTTCTGTCTCTGTCTGGTGAGCGCACGCGCCCTATAGAACA
AATCTCTCCCCCCTCCCCCCCCAAAAAAAAAAGAAAAGAAAAGAAAAAAAAGCCGCTTGT
TTTCATAACTGCATTCAGTGGTCTTTAATGCAGGCTAACTTTCTTACCCATTCCATGTTA
GAATTAAAAGATATCTTAGATCCCTTCAAAGATTTTCTCTTAGAATCTTTCTAGTACAAA
CCATGTTTTGAATGTTCAGTGATGAAGAAGTCAGCCTAGGCCAATCAGTAGCATCAAAGG
AAAATTCCAAATTTTTCTCACATATATCTAAGCTACTTCAAAATGATTAGCATAATATCT
TAAAAGTATAAATGAATCTCTAGAGTGATGTGAAAAGTTTGAGAGCAAATAAAAATGTTT
TTGCCAACATTTTTTACTATATATAGCACTATGAAATTATTATTATTTTTTTTAAGAGAA
TTTTGCTATAGGGCGCATGCACTCTCTGGAGAGACATAAAGCAAGATATCACCCACCCCA
CCTCCACCCCGTCCAAGGGTGATGGCTACATTGCAATCCCTTCTCTCTCCTTCATTCTTT
TCTCAGGAGTTTGGGCATGGAGGCACACACTACCAGCATGAGTTTTAAGCTGCTGGGTCT
AGGACTCCAACCGGCATTGACTATGTGGGAGTTCAGTGGTATAACCATTACTCCCTCTGC
TGGTTCCAGCACTATGAAATTTATAGGACATGATACAGAAAGAAGTGGTAACATTCAGGC
TAGTAGTATTTGCCCTATATACTAAAAATATGTAGCATCATACATATAAGTGACCAAATG
ATTGCTACCTTTTAATGTAATGGTTCCACATATTTGAAAATTAAGTAGAATTGGTCACTG
AGCTAATAATCTCAACCATTCATTGTCTTTGAGAAGAGAAGTATATGATGGAGGGAGAGA
GCCAAATTGGCATCTGCCAAGTGGCAGATGTTTGAAATCAGTTCTTAGTCTTTATTACAG
CCTCAGGAAAACAGCAGTTTCCATATCTTTAATATTTTTAGAAATTGGCAACTTTTACTT
AAAATATCTGGGCAAGAAGTGGTAGGTGGAGCTTAATTTGAATCCATTCTGTCTTCCCAA
ACTCTTCTCTTCCACAGGTTGATTGCTTTTTCTGTTAGTCCTTTTCATGTATCAAAGTTT
CTGAGGAAGAATTGGCTTAGCTTATGTAGGAAATTAAAGGGAGGCTCATGTGATTGGGAT
GGGATGAGGCAAGGAGAAAAGAGTAGGAGGTAACATTAGGGTGAGCTATTTAATGAGATG
AAGCATGCTTGGTAGACTACCATAAGAGCTTCAACTGGGGCTGGCAGGTGGCATGATGGT
TAAGGGTGCTAGATATGGCTGACTGGTTTGAGTCCCAGACCTGGCGGCTTGCTCTCTCTT
TGCCTCTTTCTCTTTCGCTCTAACCCTCTCTGGTCAAATTAAAATAAATAAAGAAATAAA
TGGCTAAAGAAAAAGAACTTCAACCAATTTTAAGTATGATGAGATGCCAATAAATAAAGG
GTTTGGAACAGAGAAAGGGAACATAAGAGCTGATTGAGTGTGTTGAGTGTGTTATGGAGT
ATGGTCCATAGGTGGCACCAATAGAAGTGGGTGTTTAGTTACTGTAGTTTCCTAGTAGAG
AGTGAGTTAGTGTACAGTTAGTGGAGAATATAAGAATGGTCAGATTTAGCAAATGTTTTA
AGCATCAAGATGACAGCATTTTGATAATGGAGTGGGAATGTGGTATGAAGAGTAAGCAGT
AACTCTTTTTTTTAAATTTGAACCTGTATGGGAAGACTGAAGAAAGATTGGGTTTGAGGG
GAGAGAGAGAAATTCTTCAGAGATCTTTTCCCAAAATTCACTTGCAAGACTAATTATGTA
GGCAAGAAAATAAAATAAAGCAGAGTCAAGAGGTAGAATATGGTTGGAGCGAGGGAGGTG
TAGTTTCAGATAATGGTGGTTGACAGTCTTTGGGACTCATTAATGATGTTTGTTAAGAGA
CTTGAATGAAGTGAGAAAGCAAGATATTCGGGTATCAGAAAGGGGCGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNACAGCAGTCATGGAGAAAAGTTTTCCAGAAGGA
AATTTGTTAAGTGCTGTTATAAGTGGAGGAATTTAAGCTGATCATTGATTATCGGGTTAG
TAACTTGGAAGTTAGTGGTATGGTGAGGACCAGAAGTTTTTGATTAGAAGGAAATTTAAG
AAAACAGCAAAGGGTGGGGAAGAAGAAAGTTGATATACCTCTTGGAAATTTCTGTGGTGG
AGGGGTGGGGTTTTTTTAGTGTGCATGTTTATAAAAGCTCAAAAGAAATGATGTAGTAGC
TAGAAGAGGACATGGGATTAGGGCAAGATTTTTTGATTGGTTGATATGATTTTTTTTTCA
AGAGTGAGTTTCTCTTTGTGTCTCTTATTCTTTATTTTACTTAGCAATTTGCTTCTGAAG
CCATTAGGTGGGGCAGGTAAAAATAGTCATATCTTGTCATATACACACATTGACATGTGT
ATATGCGATACAGATGAATACTTTGACCTACAGTTACCTGGGCAAGAAGTGGTAGGTGGA
GCTTGGTTCATGTGTGTCCCTTGGAAGGTCTACTGGAAGGTCCTGAAAGCAGTGGTATCT
TCACAGCTTAAGCGTATCTAGCTCCCAGTTTTTCATTTCTGAGTACAATTTTCCAATAAA
AAGAAGCCTTTTTGGAGAAATGTCTGATTTCAGAGCTGGGGCAGAGAAAGTACAATATGA
GCCTAGAACATCTTGTGCCAGAAAGTAAGGAAGAGCTCAGAATGCTGGAGACATGTCAGG
AGGGCCTGGGCCAGCTCACAGGGCTTCTCATTGGCTAGTAATCACAGTAACAGATTATAA
CTCATTGACTAAAATAGAGAGCAGTGAGTCCAGACAAATACAAATAAACAAACGAATATA
TTAAAGATTTGAATTGGAACAGGATGTTTACAGGTTTTGAGAGTACCTCTTCACAAATGC
TCATGAATTACGAAGAGGGAAAGAGTAAGCTTAAGAGGTGTAGTGGTGGCGTTGGCAGAA
CGGCCTTCACTGCTTAGAGTGAAAGTAGTCAGTGCTGGTACAGATTGAAACCAGACACTG
CCTAACGGTGCACCAAGAAGAATGCAGTGTCACTTCGGTGACTTTCCTGCCTCAGAGTCA
TAAACTGAGTGTAGTCTTCAGAAACACCAGACTGTAGTGAAAGAGACATTTTGTAAAGTG
GCTTAAGTGTCAAGGTCATGAAAGCCAACAAAGATTGAATAGTTGTGCCAGAGAACATGG
GCTGTAACTCCATTCAGTGCATGATTCTAAAGGGTCTTTTTGTTGTATAGGACATTATTG
GGGCAAACAGTAAAACTCGAGTGAGAGGGTTAGCTTTTACACTTTGAACTTCTCTGTAAG
TTTGTGATATTTCAATATTAAAAAAGTGAAAAATGTGGGTGCTATTTCTTTTTATTTTTA
ATAGTTTTTTGCTATAGGGTGAGTGTGCTTGCCAGAAAGTGAGAAATCACCCCCCCCCCC
GCCCCGGGGAGGGAGGGATGGCCACACCTGAATCCCTTCTTTTCCATTCTCCTCTCAGGA
TCTTGGGCATGTACGCACATGTGCCAGGCATGAGTTTAAGACACTGGGTCTGGGACTCGA
ACCACCGTCAACTACATGGGAGTCCAGTGACCTAGCCATTACGCCAACTGCTGGTCCACG
TGGGTGCTATTTCAATACTTGTATATATACCTGAATGCAGATAATGGAGTAGAGATGGGA
AATGTATATTTAAGAGAGGAGAAAAATTAAGTTAGCCTGTGCTGGGTGGTAAGAATGGAG
GGGTTAGTTTGTAATGGGAGAAAAAAAGATTACACAGTTGCACATGAGTTAGTGGATTCG
ATTGTAGGAAAATATGGAGATTCTCTTCTGATTGGTTTTTCTTTTCTTAATGAAATCTGA
AGGATGGCGTTTGGCTCTAAGGAAGAGGAAAGGGTGTTTTCAGTAAAAAAAAAATTCAGA
TATACCTGTGGGATAAAGAATTTCACAGTGTGTAGTGTTTTCTTATTTGTTAGTTTTAGC
TTTTTTTTCTTTTTTCCTCTATTGGAATTTGTACAGCAAGTTAACTTTATTCCCCTGAGC
TTAAAACAAGTTGATCATCAAGAAGGTGTATTTTTCAGAATGTTATATGTACTTAAATAA
TGTATAAAAGGAATTCCCAGGTAAAAGGAAATAAGTTGTGAAAAGAAGAAATCAAAGATG
AAAGCTTGGCTAAGATGTGACTTCATGGTGTCATGGCGAGATGGGAGAGAGCCCTTGTAG
AAAGCATTAGTGGCACTGAAGGATCCCAGTTTGTAGAATTAGTCTGAGTTTTAAATCACT
GAAGAGATCTCACTGATCAAATGTAGCATGTTGTTCCATTTCCTTATAAAATAGGTTTCT
TTCTTGAATGGAGCATATCGCATGTCATAACGTTTAATTAGTATTGTGAAAGTGAGGTTC
CTTGGGATTAGATGGAAGATTGCTCTTACAGGACTGAATTTTTCTTCTTCCCAATCAGTA
AATAGCTTAGTGTTATCTCTGAGAATACCCTGCATTATAGTGAAACTGTTTTCTTTCTCC
TTTTTTTTTTTTTTTTTAAATAAAAGTACTAAACATACCCGAGGGCTCTGTTAATCTTAT
GCCTGTGCTGTGACCCTCACTTTCAGCTCTTATTGTCCTCTCTAGGCTGGTGAGATTGGA
GAGATGAAGGATGGGGTTCCAGAGGGAGCTCAACTTCAGGGACAGGTTCATCGGAATCCA
ACTTACCGCCCAAGGTACCGAAGGTATGTAGCATTCCCACTAAGTTGTGACCGCCTGAAG
GACTCGTGAGAGACTGGCATGGCTGAGGGTACCATGGTCTGTTTTATGGATTTAGTAAGT
AGATAGATGTGGCTCCTTTGACCATATGCCAGAGTTTCTGTGGAACTCCTTAGTATGTGT
TAGCAGGTGGCAGTGTGATATTTCTCTCCTACTTAACAACTAGAACTTGAATCATGGAGG
CAATCCAGTATAAATGGGTTCTTTCAGGCTATGTATCAAATTGCCAGTATTTAAATTCTC
ACTCTGCATGTTAGTAGCTGTATGTCCTTAGGCAAATTTCTGGACCCTTTAAGCCTTAGT
CTCCAGGTCTATAAAGCAGGCATTAAGCAATGTTCTATAACTGCTTGTAGGATTCAGTGT
AGGATTCATAGTGTATCTATGATAATCAATGTGATGTATAGTCAGCCTTTAGTAAATATC
AGATATTGTTACCACCAGTGACACTAGTGTTAGTGTAGGAGCAAGTTATTTAATTCGTGC
TTTATTTGTGCCCTTATGAAGGCCGAATCAAGTTAAATTCCCTAAGATACTTCTGAAGTG
TTTTCTATTACAAGTTTGCCTGTTCCTTTACCTTAAGGTAAGTGGAAAATGTAGACCTTC
CTTCCCAAGTGTTATTTATGCTACCTTGAAATTTGTCACTGTGGGTTTTTTGAATGGAGA
GTATTATATGTTAACATTACTTATAATTGGTGATATAATTATAGGTATTTGAATATGATA
TAATATTAATATAATATTGATTTTAATTAATATAATGTAACATAATAGAAAGGATTTGTA
GGGATATAAGAATATATAGGAAAGAATTTGTACTAGTCTCACCCTTTCTTATAGATTCTT
TCAGGTTTTAGGGGAAGACCAATAAATTATTTACAAAGGATTGTAAGACTTGACAGAAAT
GCCTTATTGAGACAGAAAAAGAGGCAGTAGAATGGATAAGGGGCTCGAAGATCAATTCGG
TACTAAGCCCATCTGGGAAAAAGGCCCTTTGAACTTTTTTGACCTANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATAAGAATATATAGGAAGAATTTGTACTAGTCTC
TCCTTTCTTATAGATTCATTCCAGTTTTAGGTGTAATTACTAATGATTAATTACTAAGGA
CTTGTAAGACTTGACAGAAATGTCTTAATGAGACAGAAGAGAGTCAGTAGTATTGCATAT
GTGCCTCCCAGATCAATCCGTAGCTAGGCCATCTTGGAAAAAGGCTCCTTTGATCTTTTT
TGACCTATAAAAGCGGCACTTCTCTATGACTCAAGCACATCCTTACTGTCTGTAAACCTC
GGGTTTCTCACTGTAAATCTAACTCATAGAACTAGCACTGACGTTGTGTTTTTAATGTGA
AAACATACTAGCACAGCCTCCGGCACACAGTAATGTTAGTTTTCTTCCCTAGTCGCTACT
AAGTCCTGTTCATGGAGTACAGGTACCAGACCCTTTTCTTTTTTTCCCTGTTAATTTTCC
TATCCTTGGTGCCTATCAAACTGCACTAGGAACATAGTTTGTGTTCAGTACATGTTTGTT
CATTACATCTGTATTCAGATGAAGGGGAAAATAAGTTCTATTTTCACCCACCTTCTGTTT
TAGTTTGCTGCATTATCGTGGGAATAATTCTAGCAATAAGTCCTGATCACTTTTTAATCT
TTGTAAAAATAAATTAAACCTAATATTCTTGAGAACGCCAGTCCCCTTGCACTTGTTCTG
TCTGGTTCTGTCTTCTCTGCTGTAGGGGACCTCCTCGCCCACGACCTGCCCCGGCTGTGG
GAGAGGCTGAAGACAAAGAGAATCAACAAGCGGCCAATGGTCCGAACCAGCCATCTGTTC
GCCGAGGATACCGGCGTCCTTACAACTACCGGCGCCGCCCCCGTCCTCCTAATGCTCCCT
CACAAGATGGCAAAGAGGTAACTCTAGCCCAACCGAGAGGGTATCGCCAGGCCATCTGAG
TCATGGCAGAGTGGAGCACTCTGAAAGGGTGGTCTTACTGTTGGGTAACTTCGTGTTTAA
CAAATAACGTTTTGCTTAAGATCTACATAGAGCATGTCTGGCACCTAACACAAACGGGAT
ATTTGAATTCAGCTAATTAATGCTCTCTGAAGAAATTACCCACACTAAAGGGGACTATAG
CTAAAACATTTAGGGCTGCACAAATAAAGAACATTTATCGAGAGGAAGCCTGCCTCTCAG
CCCAAGCTGAGAGCAGTTGTTACAGACTTTACAAAGAGTGGTGGTATTTCCTTGTCATTT
GGCAGTACTTAACTTTTACTCATATATAAGAACAGTTTAATTCTTGCATGCTGATTTTTC
TTTGTAAACAAAGAAAATTCACATTTGAGATAGTATTGACCTTAGCATTGTCATCTGAAT
TGCTTCACTTCTGGTTTGTGGTGGTTTTATGTTTTAGACCAAGGCAGGTGAAGCACCAAC
TGAGAACCCTGCTCCAGCCACCGAGCAGAGCAGCGCTGAGTAACGCCAGGCTCCCCAGGC
ACCTTCACCATCTGCAGGGTAAGCTGTGAGCAGTCCCCCCATGATTGGTCCGTAAACTAT
TACAGCTCTGCAGGTCCTCTCTGCCAACCTCCATCTCCATCTGGATGCTGGGAAAGGGCA
GTTCTGGTGGTTAAATATCTCTGGGGTTGACATTATTTTGATAAGCTTGGGGGTTCTAAA
CAGATAGTTGACGATAATTAATTTCTTTCTAGGCAGTTTTAAAATTTTTCTGTCTTTCCT
GAGAGATGTGCATATGTGAGAGGGGATGGGAAAGAACAGGCACCAAAAACAGGGTGGCTT
AGTGCCAAGATCCCTCGCCTTGCCTTCCAGGCAACCAAAAGCATAGATGCACTCATGCCC
GCATGTTTCAGGTGGACCTAGGATTTGAACCTGATCACCCACATGGCTCCAGCACTGAAG
GGCAGTGTGCGGAAGTTCCTGACAGACCTGGCATTAGAAGCAGAAGACCTTTTTTTATAG
AATAAGCTAGAGTATTTTCTCATTCGCCTTTTCCCTTGATGACCAGCATTACTCTTTTGT
TTTTTATTGTGGAAGAGGTTTTTGCTATAGGGCGTGCATGCTCACCAGAAAGACTGAGCG
CAACAGAGACGCAGAAAGTGAAAAATTACCCCCCAGAGGCGATGGCCACGCCACAGTCCC
TTCTCTATTCTCCTCTCGGGATCTTAGGTACACACACACACACACGCCTGGCATGAGTTT
AAGCCACCAGGTCCAGGACTCGAACCGTGGTCGGCTACATGGGAGTCCAGCAACATAGCC
ATTACGCTAACTGCTGGTTCCCTGACATTACTCATTTTGAAGCAAAGCAGTATAACATGA
GAGCCAAGGGATTTTCCTGCCTGGTTGCAGGCTCTGTTGCGGCTCCCATTTGCCAGGTGA
TCTCAAGCAGTGCATTCACCCTCTGCTGCCCTGATATCTGCTACTGAGAAATGGGCTGCT
ATGTACTTACCTGAGGTTGGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1042, 1045..1062, 1064..1090, 1092..1114, 1116..1128, 1131..1145, 1148..1177, 1180..1218, 1220..1247, 5589..5652, 6601..6634, 9681..9770, 11628..11750, 15040..15246, 20985..21082, 22942..23116, 23617..23682
1001..1042, 1045..1062, 1064..1090, 1092..1114, 1116..1128, 1131..1145, 1148..1177, 1180..1218, 1220..1247, 5589..5652, 6601..6634, 9681..9770, 11628..11750, 15040..15246, 20985..21082, 22942..23116, 23617..23679
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved