Tupaia_belangeri Locus Mono:49:SNORA42
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:49:SNORA42
Tupaia_belangeri
Mono:49:SNORA42
scaffold_96585
SNORA42
1001..1127
1647
AAGTCCTCCTTCCCTGCTTCCACCAGATCCCAGCTGTGGGGTGATTTCGGTCTGTTTCG
GTCTCTTTCAGTCTCTCTGCTGAGCGCACCGCCCTATAGCAAAAGCCTCTGTCAAACATC
AGCAACCCTAAGGAGGCTTCCTCACCCTACCCCCCCACCCCCCACCCCCGCTCTTTGAGG
CTGGGATGCGCTTTGAGCAGAAGAGACGCTGATGGCCTCACGCTGCTCTCCGTCCCCCGA
GGAAGGAACGCTCCCTCTGCTGAGACTCGGACAAATCCCGGGAGGCTTTTCATGTCCGCC
TCTGAAAGAAGTGTGTGGGGAACGGGGTCTGGAGGGAGGCTGCTCCTCTGTGCAGGGTGG
GGCACGGCCTAGTAACCAGGGTGGACCCCAGGAGCCCCACGAGGTGGATACTCCCAGCGC
GTGCCACAGAGACACCGCCCTCGCCTCCCCGTTCCCCCTCACCCTTTCTGTTACCGGAAC
TGGACATTTATGAAGCGGATCAAAACACGAAACAGAGATATGCATGAGTCTGGCTTTATG
GCCAACTCGTCCTCCTGGGTCTCTACTGTCACCCTCCAGAGCAAACAGGCCCCGAACCAC
TGCCAGTCTCCGCCTGTGGGCTGCTGGCACCAAGTGGGTCACACGGTGGGAACAAATGAA
CAAAACAAGCAAGCAAACACAACAAAACTAGCTGATTTTTTTTTTTTTTTTTTTTTGCCA
TAGGGCATGTGTACTCACCAGAAGGCCAGAAAGCCAGAAAGTGAGAAGTTACCCCCCCAG
GAGGGATGGCCACACCGCAATCCCTTCTCCTCCATTCTCCTCTCAGGATCTTGGGCGTGC
ACGCACACATGCCCAGTGTGAGTTTAAGCCACTGGGTCCGGGACTAGAACCGCGGTCGAC
TACGTGGGAGTCCAGCGACATAACCATTACGCTAACTGCTGGTCCCGAAACCAGCTGATT
TTAAAAGCCTCAGTCAGAACTGGAACCAACCGGGTAGCCAGCTCCTGAGCAGTAGCAGCA
GCAGCAAGCTCCACGAAACCCAAAGCTCCAACCTTTGACCCAAATACTTTTTTTTGGCTA
TTTCTGTAGGGCATGTGTGCTCACCGGAGAAAGTCAGAGACAGAGGGACACCCTTCTTGG
GATTTTGGGCATGGATGCACACGAGCCTCGCATGATTTTCAAGTCACTGGGCCCAGGGCT
TGAACCACTGTCAGCCATGCAGAAGTCCAGCACCTTAGCCACTAAGCCACCTGCTGGCCC
AGCCCAAAACACTCTTACGAATTGTGCAGACGGGAGCGCTGAGCGGCTGGCAGCAGGATG
CACCAGTTCCCGCGGGGCTCTTTCGATGGGCTCCTGAGAGCCCAGGCACGTCTGTGACTG
CATCTCTGGTGTCCCCTGGATGTCTGTGCTGTCGTGACCCGCTACCACATCAGGACACTG
CATCCGTGACGTCACAGCCAAGGCTCATCGAAAATGATAGATTTCAACTCAGATTGTTTG
GACAGGCTGGATGTGGGAGACTGATGTCTCATCAGGTCTATTTAAACTGTCCTTGTACCC
TGTGAACTAAGAACACCTATGGGAGTGAAGTGGCCGCTCGGCCATCAGCACGAGGGACCC
TGCGCAGGTTCCTGAGCATTACTGTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved