Tupaia_belangeri Locus Mono:152:SNORD55
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:152:SNORD55
Tupaia_belangeri
Mono:152:SNORD55
GeneScaffold_1543
SNORD55
1001..1078
2078
GAGACAAAGACAGAAAGCGAGAAATCAGCCCCCAGGGGGGATGGCCACGCCGCAATCCC
TTCTCCTCCATTCTCCTCTCGGGATCTTAGGCACGCATGCACATGTGTCCCGGCGTGAGT
TTAAGCCACTGGGTCCGGGACCCGAACTGCGGTCAACTACATGGGAATCCAGCAACATAG
CCATTATGCCAACTGCTGGTCCCTGGTTCAAATGTTTTCTGAAGACATAAGTTCCTTCAT
AGGAAGTCCTGCTTTGTTACAGAGAATAGAAAGGGCAGAATTTCTATATATCATGTAAAG
AAAACCAGGAAGACATGTACGTAAAAAATACATCAAATCATTTTTTTCCCTCCACCTGAA
AATAAATTACCTCCCAACTCTAAAAAAAAAGGTGTAAGTTTTCGTTGTCCTCTGAAACAA
TGAACCACCCTCCAACAAGCTTTCTTATTTATCTGTCCTCTAATTATGCCACAAAGAAGA
GCCAAAATAAATTTTTTGTGAATTAATCATACTTGTTATAAATATCTCTGAATATGTATA
TTTTTAGTCTCTTTGATTTATTATTCAATATGATAGGTTAATTTATTTGCTGAGATCTTA
AGTATATATAAGCTAATAAACTAGTCTCAAGATGAGAACACACATCCACAAAAATCATTT
TCTCTGAGAGCTGAATCTAGAAGGTGCACTTAATTTTGATCCTTTCAGAGGGAAAATGGA
AACGGAAATGCCACATAAGCAAAATAGAGAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNATAGAACAACACAGAAAAGTACGTCATGACTTTCCCGACAACCTAA
TATCTGAAAAACACAAACTTCTCACTGCACCCTCCTCTGCATCCTTCTTCCTTTGCTTCT
TTGCAAGCAAGACTGCTTAGACCATCAAAATCTTACTATAACGTGGTGATGACACCTTGG
TCATGCTGCAGACTGCCGAGTCGCCGTGCGGAAGCCAACCTTGGAGAGCTGAGCGTGCGG
CCCACCAGCAGCGGGCGTCTGGACCTGGTGGCGAGCCGCCCGCGCCAAGTCGCAGTGGCT
CAGGCTTCCCACCCCGCTCCCACACACAGGTATCTCTCAGGACAACTGGCATAAGCGCCG
CAAGAAGAGAAAGCCCTACCATAAGAAGCGGAAGTATGAGCTGGGACGCCGCGCTGCCAA
CACTAAGACTGGCCCTGGCGGCAGACACACACTCCATGCGGGGAGGTAACAAGAAATACC
GCGCCCTGAGGCTGGACGGCGTGAACTTTTCTTGGGGCTCAGAGCGTTGTACAGGCAAAA
CAAGGTTCATCGATGTTGTCTACAACGCATCCAATAACGAGCTAGTGCGCACCAAGACCT
TGGTGAAGAACTGCATCGTGCTCATTGACAGCACACCGTACCGACAATGGTAGAGTCCCA
CTATGCACTGCCCCTGGGCCGCAAGAAGGGGGCCAAGCTGACTCCTGAGGAGGAAGAGAT
TTTAAATAAAGCGATCGAAGAAAATTCAGAAGAAATACGATGAAAGGAAAAAGAATGCCA
AAATCAGCAGTCTCCTGTAGGAGCAGTTCCAGCAGGGCAAGCTGCTCGCCTGCATTGCAT
CCAGACCAGGCCAGTGAGCCGCGCCAATGGCTACGTGTTAGAGGGCAAGGAGCTGAAGTT
CTACCTGAGGAAAATCAAAGCCCGGAAAGACAAATAAACCTTCCTATCTTCGCTCTGTAA
TAAAGGTGTTTATTGTTCAAAAAAAAAAAAAAATCTTACTATAAACAAAGTAAGTATTTA
AAACCACTTATGGACCAAAAGATGTGAACAAGTGCTACAATGGGCAAAAGCATGAGTCAA
ACTTGAGTGTAACAAGTTGTTAATTCTGTGGTTCAGCTTCTGTGGTGCAATTGGTTATGT
GCCAGACTGCAGTGCTGAAAGCCACATGGCCAGCCAAGGTTTGGATCTCTGGCCCAGCAG
AGCTAAAATATGTCAGGTGTGTTAGGTGTATATGTGTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved