Tupaia_belangeri Locus Mono:13:SNORD116
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:13:SNORD116
Tupaia_belangeri
Mono:13:SNORD116
scaffold_84967
SNORD116
1001..1094
1241
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGGCTTGGGTCCTGCAGAGGTAAAAGGTACATTCTTCTGTTGGAAGTATTAGTATTT
CACAGGGGGATGGCTGGGCATAATAGGAGTAACATTGTAGCTCATTATGGTGTTGAGGTA
CACAGAGTCCTCTTCAGGATGAGACACACACAACACAGTTATTACCATATTACATGTGTA
TGTATAAATACACATACATAGAGACACATACACAGAACCCTCCTGCCCCATGTTACGGTT
ATCCACCAAGTTCAATGTGGACCTAGAGTTAGGCAGATAATAGAGGTAAATGAGAAATAA
ATGCAAAGGGTACCCTGTGGGCAACAGTGGCCTGCACATGTGGTTCTGTGTACCTGAGTC
TGTTTCTCAAGCTCCTGTGTCACGTTTCTCCCCTACTCAGGGGGAGGTGCTGAAGAAGGC
TAACTGCATACTGAGGGAAGACATCTGTCTCTTGTGAGGACTGGAGGTGCTTGGAAATCC
TGTGATGAGTGTGGCATGCATCGTGCCGACTGCAAGTGGGTCCCTCTGGATGGTAATTAT
GTCTTTGGCCAACATGTTGATGTTGTCTTCACTATGTGGTAGACGAGAAGGACCTAGGTG
TCCACTAACCATGAATGGCATGCCAAATTTTACTTTTCAACTCAACAGTCTGCTTAGGTG
CCAGGCTCTTGATTGATCAGCATACCGAAGGTCCTTGAGGTCATTGGTCTGCCTGGTACC
TGGTCCACAGTACTCAACTTGTAGCCTCTTAGAATGTGCTTGGATCGATGATGATTCTTC
TATAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCACTACCGTCTCTCTCA
TCGCAACTGAGGTCCAGCACAATGCTTTCAGTTGGGACTGTAAGAGTCAGGGTCGCCCTC
CACTGATGTACGCAATCATTCCGCCACACAGGGTGTCATACAATGGGAGTCTCCCAACCT
ATGGGCCATAGCAGCATGTTCTCAGTAAGATTTGCTAAGATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved