Tupaia_belangeri Locus Mono:194:SNORA42
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:194:SNORA42
Tupaia_belangeri
Mono:194:SNORA42
GeneScaffold_615
SNORA42
1001..1132
2132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTCACTTTCCCTCTCTCTGTC
TCTGACAAGTATACACACCCTATAATTGCCTGAGGGTATACATGCTTGCCAGAGGGGAAG
AGAGAGAAAGAGAGCGAGAACGAGAGAGAGAGAGAGAAATACCCTCAAATGGGGTGGTCA
TGCTGCCATTCTTTTCCCTGCAGTTCTCTTTCCAGTTAGGATTTTGGGGATACATGCACA
TGTACCCAGAGTGTTCTTCAAGCTTCCAGGGTCAAGAATTGAACTGTGCTCGGCCCTGTG
AGATATGGTTCTCTATGCACAGTGCTTAACCACTGTACCACAGGGCCGTCCCCATAACAT
GCGTTTTCCATGAACTTTAAAAAATAAGTTTGTGGAGGGACCGGCAGGTGGCATGGTGGT
TAAGGCACTGGACACTCCCACATAGCTGACCACAGTTCAAATCCCGGACCTGGTGGCTTG
CTTTCTCGCTTTCCCTCTCCCTCTCTCCCTATGTTTCTCTCTGGTCAAATTAAAATATGT
GAATGAATAAATAAAAAATTAAATAAATAATTCTTAAAAAAATAATAAGTTTGTGCGACC
AGCAGGTGGCGTGGTGATTAAACTGCTGGATTCCCACATGGCTGACCACAGTTCGAGTCC
TGGACCTGGCAGCTTGCTTTCTCACTTTCCATCTCTCTCCCTCTCTCTGCTCAAATGAAA
AATAAACTAATTAAATAATTCTTTTAAAAAATCAGGGCTATGCATGGGTTTGGATTTATG
GCAGGCTTGTCCCCCTGGGCCTCTCAGAGTATCCCATGGCAGAGCAAGCTGGCCCTGAGC
CATTGCCCGGCTTCTACCTGTGGGCTGCTGGCACTGAACTGGGTTGCACAGTGGGGGAAA
AAAAATCAAGACCAGTAGGTGGCATGGTGGTTAAAGGCACTGGACTACCACATGGCCGAC
TGTGGTTCAAGTCCTGGACTTGGTGGCTTGCTTTCTCACTTTCGGTCTCTTGTTCTCTCT
CTCACTCTGTCCCTCTCTGGTCAAAATTAAAATAAATAAATAAATACAGTAATTTAATAA
AAATAGTCAGTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACAAT
GTCTCTACAGTAAACACCTACTGGCTGCACAGTAAGTTCCATCTGTGCATGTGAACTCTT
AAGCATCTCCTTTACTAAGTTGTTAGATTTGTTTCTTTTTTAAAAGAATTATTTTAATTT
TATTCATTGTCTTCATTTTATTTTTATTGAAGTTAACCAGAGAAAGAGAGGAGGAAAGTG
AGAAAGCAAGCTGCCAAGTCCAGGACTCAAACCACAGTCAGCCATGTGGGAGTCCAGCCC
CCTCAACCACCACGCCACCTGCTGGCCCATTAAACTGTTTCTAATGTTTAGCCACAGCCA
ACAATGCCATAATTATGCATGTAGAACTTTTATTCCGTTGAACTATTTCATTAGGATAAA
TTCCTAGAGTGTGAGGTTACAGGGTGTAAGGTTCTGGGCTGTTTAGGACTGTATTATTAG
GTGTTACTAACTGAATATTGTGATGTCTTTATTATTGCCTTTCTAAGGGGCCCGTTGGCT
TTCCCTCAAGTGAGCAAAAGTTCCCCACTGTGCCTTTCAGCATTCAGATTTGCAGGAAAA
ATCTAAGGACCCTCCGACCCCTCCCACCTCTCCCACTCCCAAGGCACACACCTGTTTCTA
CCTACACAGTGTCACTCCTGGGATCTGCGTGGCAGAATGACTGACAGGGACAGCAAAGTA
CAGCTAGAAGAGCTGTCACAGGCGTCACCCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved