Tupaia_belangeri Locus Mono:46:SNORA70
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:46:SNORA70
Tupaia_belangeri
Mono:46:SNORA70
scaffold_92007
SNORA70
1001..1132
2132
TGGCTCCTAGAGAGAAAAGGCCAGGGCTTTTCATCCTCCATGAGGGCTAAGAATACCTG
AGTGAATATGACAGAAAAAGCTCCAAAGGTTTAATGTAATATTTCAAGAAAAGAAACTTA
GGCTAAGACGTAACATGAATGAAAGAAAGGTTATCATTTTTGAGTGTCTTCTTCAGGAAG
CTACTTGTTGAAATCACTGTTAAACTGTTTGATTTCATCGTTGGGAAGCAGATAGCAAAA
GCTGTGGAGAGGCCGTGAGGTAGAGAAAGGGCAAAGTTTAACACCTACCTTTGTTCCAAA
GTGCACTGACTCAGACAGAGTACAGCCAACCAGGAATTAGACACAGGTTCAGTGAACATA
TTTAATTTAGAATAAGTAGCTTCATTAGTACATCTAAGAAACCACGCATAGCTGCTAAAG
CCCTGTTAGTGTATAGAATTACATTTTTTAAAAAAATCCCTTAAATAACAATAGTTGTTT
TCAGGAAACAAAGAAAGCTTTAAAAGTTTAAGTACAGGAGTTGGCAGGTGGCTCAGTGGT
TAAGGTGCTGGACTCCCACATGGCGAACTGCAGTTTGAGCCCCGGACCTAGGGGCTTGCT
TTCTCACTTTCCCTTTCTCTGTCTCTCTCTGATCAAGTTAATAATAATAACAAATAAAAA
ATAATTTAAAAAAAGTTTAAGTACATTGTAGTTGGGACCTGAACATAAAACATTTATATG
GAAATAGGTAAAAGAGGTGACTATTTCTGTGTAGGCCTTTTTTTTCCTTTAATTCCTGGA
GGACATGTGCACTCAACAAAGACAGAGAGGGGGAGAGAAAGCACCACACAGTGGGAAATA
GTCATGCCGCAATCCCTTCTCCCCCATTTCTCCATCTTGTCAGGACATTCGGCATGCATG
CACATGTGCCTGTAGGTTTCTCAAGCTCCCAGGGCAGGATTCAAATCATGGTCAGCCACT
GGGATATGGCTCCCTTAACCACTAGGCTATGGCAGCCAGCACTGCATAGGCTTTTGAAGA
GTCATAAATATTCTTCATGGGGTCTAGTGTGCAATGGTTGCAAACAGCAGACTCCTGGGT
ACCGTGCAGCCTGTTTCTTGCAGGAATTGCCCTAAGGGACCTTGGAGTCAGCCCTTTCCA
ATGGTTGTTTGTGTCTTTGCCTCATGCTGTCTGTATGCTAGACTCCAGACAGGTATAAGG
GGGTGACTTTGGAAAGCCCCAGGGCACTGTGGCCAAGTCCACAAATTTGGCAATTGCCAT
GTCCATTTGCACCAAGCTGTAGAACAAGGGGCATGTGATTGAGGCCTTGCATGGGACCCA
GTTCAAGTTCCCTGGCTGCCAGAAGATCCACATCTCAGAGAAGTAGGGCTTTACCAAGTT
TAATGTGGATAGTTCAAAGACATGGTGGCTCATCCTGATGACTATGGTGTCAAATCCATC
CCGGGTCCTGGTCCCCCGGACAAATGGGATTTGTGAAAGTTTCTACTGTGCTGCTCCGCC
TAATCACACTCACCTATAAATCTTCCAAAAAAGAGCTATAGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved