Tupaia_belangeri Locus Mono:50:SNORA71
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:50:SNORA71
Tupaia_belangeri
Mono:50:SNORA71
scaffold_112637
SNORA71
1001..1133
2133
ACAGGAAGCTAAGTGACAAAAACATAGGTGAGGCATTTGGGTGTAATCTTCTTGGTTAA
GTTGCTGTTGTCGTGGGTTTGGCGGTAAAAGACTAAAAGAAAAAAAGATATGTGGGTCAT
TTTCTACTACCTTTTCAACTACCTTTGCTGTCAGTTCATCCATAAGCTCACTTTGGCTCC
TGCTGATCGATGTTTTAGTCCATCATTTCGTTCCACACATATGTTCTGAGAACATAATAT
GTGATGGTAAGGCATTAGATGCTGAAACAAAAACAGATAAGCCGAATGAGGCTCTTACTC
TCAAGGAACTTGAAGTCTGATGAAGTTGACAAACACTGAGTAAGTGTGCAGAGAGACTGG
CCATTTGGAAACTGTAAAAATGGAGTTTGGGGAAAATTCCTACCATGCTTTTTCCCTTTA
AAAACTGGTATAAATAATATACGAATATATGCATGTTGCAAAATATGTAAACAATACAAT
ACTGTGAAAATTCTCCTTCCTTCTTGCTGTAGCCTACATCCTTCCTTCAGGTAAGTACTG
CACTTAACATTTAAAATTAACATTCAGACAAGTACTTCCCTACATACTTACATGTACATA
TATAGAGGTTTACTTTTTTCTTTTGTATATAAATGAGATTATACCCTAAATATTATCCAA
TTGCAAATCTGAAATGTTTTCCATAAAATATATTGACCCTCAAGTTTTAAAAAATATTAT
TAAGATTCATATACAAACAGAACATAATTTGTATAACCATTCCTCTTCTGAGGGGTATAT
TTGACCACTGTAACAAATTAGCACAAACTAAATGGCTAGTACAATAGAAATTTATTCTTT
TACAGTTGTGGAGGCCAAAAGTCTGAAGTAAGAATCATCTGGCTGAAATCAAGGTGTGAG
CAGGCCCACATTACCTCCAGAGACTCTATTTCCTGACTTCCAGATCTCAATGACTGTCAG
CATTCCTTGGGTTGGTGCTATATCATCAGTAATACTGTACCCCCTGCATTGGTAAGTGAT
CACAGACTGCTCGTGTCCTGGTCATTGGTAGTGCAGACAGAGGAAATGGGAAAGGGTTGC
CCAATGTTTGGAGGGTCCATGTATTTGCCTTTCAGTTCTGAGAGCTTTCCCACACTCCTG
CTTCGCAGCTCTGCATGCACTTTGGGCCTCCAGGGCATTGGGGCTGCCATGTGTGTGTTA
TTGTCATTGTGGGTTTTCACTTCCTGCCCCCCTGTTGGGGGGCCATGTGTGTCCCTTAAG
TTTTCCTGGATGATCAGCAAGGTCACTACCAGGCAACCATGGCACTCCTCAAACCTGATT
TTGACGTCCATTTCAGCCTGTCGCTTGGTCACGTGCTCTTAGTGTTTGACCATCCTGCAT
AGACCATTAGTGTCTCCCTCGTTCAAGTTGACTACTTTCTCTTTTTTTTCTTTTCTTTTT
CCTTTTTTTTTTTTTTTTTGAGAGGTTTTTGCCATAGGACGTGTGCACTCACCAGACAGA
CAGAGACAGAGAGACAGAAAGCGAGAAATCATCCCCCAGGGGAGATGGCCACGCCGCAAT
CCCTTCTCCTCCATTCTCCTCTCAGGATCTTGGGCACGCATGCACACGTGCCCGGCGTGA
GTTTTAAGCCACCGGGTCCGGGATGCAAACAGCAGTTGACTACATGGGAGTCCAGCGACA
TAGCCATTACACTAACTGCTGGTCCCCACTACTTCTTTTCATTAGGAATAATGTTACTTA
GAGAGCAGCAGTCAACAGTGTTGGAATGCTATTTGGTGTCTGCTGTCCCTTTCCCAGTGC
CTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved