Tupaia_belangeri Locus Mono:226:SNORD93
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:226:SNORD93
Tupaia_belangeri
Mono:226:SNORD93
GeneScaffold_1875
SNORD93
1001..1074
2074
TTTAACCACCATGCTATTAATCTGTGAATAACCCTAAAAGACAGGAAATGCAATGGTCA
TGTTCACATTTGCTTTTACCATAGCTTTAGATGTTATCAGGGATTCCTGTAGAACCAAAA
TGTTTTTACATTCCACTAGATGGGTGAAACCCGGGCACACAGCATGTCAGGAAGGCATGC
CAGGAAAGCTACATGATCTGGTGTTTATTTAAGGATGATGGAAACTGAGCCCATGTCCAG
AGCTAGAAACTGCTCTCAAACTCCTGGGCTGGGGCTCAGGTTCAGCCTTAGGTAAGCAGG
TTTCATGCCTCTTTGATTTAAAAATCTGTGGAAGGTTTCAGTTAGCTTTTCTTCTAGGAG
AATACTGTTGCCAATAATGTTTCTATTCTAAAAATTCATGTACCCCATGCTAATGTAACA
AAGAAAGATGGCAAGTGCTGACTTAAAATGGATTTCCAGAGGGTAGCAATTTAATTTGCT
TGATTTTAACTCCTTGCTGGAAATAAGAGGACTCTCAAGTATCAGGAAATTTGGAGAGTA
CATCTTTATATGGGAATTCTATTCAAAGATAACATTTTATTCAACAAAGCTAGCTAGTAG
ATAGTCTAAACAACAAGAAGTTAAGGCTTAATATTCATGTGTCCCCTTTCCCCAGAGGGC
ATGTGTACTTAAGGAGAAAAACAAAGTGAGAAAGCATGCTTCATGGGAGATGGTCAAACA
GCAGTCTTTTCTCCATCTCTCCTTCCTTTCAGAATTTTGGGTATGCACACACATATGCGT
GGTGTATTTTTCAAAGCCTCTGGGTCTGGAATTTACTATATACTTGACCATGTGGGATCT
AGCTACTTTAACCACCACACCATGACTGGCCCAAGGCATTATATTCTTAACATTGTTCTT
ACCACTTTTTTCCCAGGCTCAGTGGAATTCAAGATCGGATGAGTTCAAGAAATGGACCAA
ACAAATTTGGCTTGAGGTTTTTAATAGTGAAATAGAATTCTTGGCCAAGGATGAAAATTC
TAATCTGATTTGCTATGCTTCTGCTCTGATGGGTTAAAGGATTTACCTGAGGCCAACTTG
ATGTGCAGGAAATTAATAAATGGAGTCACAGGACTCCATTAAAAATTAGGCTTTAGATGA
AAGGGAACTAAGGCCTAGTAAATGAGTAATACTTTATTAAGGCGAAGGAAAGTTAGGTTT
TTAAGAAAAAATTGTCAGAACACACTTAAATCAACAGTGGTAGTATCCTGGGAGTTCTTA
TTTGCTTACCTGTACAGTTTTAATCAACATTATCTAGACAACATTGTATTATGTGTAAGA
GGCTGCTGATCTAATTACCTACTCTTCTGTGATATTTCTTTTACAGGTCTGGTGCCCAAG
ATTGGTATCTGCCCATTTGTGGTAAAATGTGAACCTATCTTCCTTTGGTTGAGATACTAC
TAAAAAAAAAAAAAAAAAAAAAAACCTTCCAGAAGTTAGCTCACTTTTTAGAAACTTGGT
ATGTATAATTTCTACACATATAGGCTTTTCCCATAAGTCATTGCAGTGATTGGATTTGAC
CCTTTTGACAGAAAATAGATGGTGTTAAACTATGACCTTGGTAGGCCTCCATATGCAAAG
ACTTGGGTCCTTATAAACAAATCACAAACTAACTTTAAAGTCTATTTCCATAATGAATAG
TTTAGTCATAGCCAATCACAGCTGGACCATTGTTTAAACTGTTCAAACAAGCTAAAGCCA
AGGTGTAACTATTAGATGTCCCCTGAAACAGTTTACAAGATTGAAAGTAGGTGAGAATTC
TCTACTGGCAAACAAAACTACAAAAATGTTTCAGACTGTGCTCACAGATAGGCCCATAAG
GTCACAATGGCAAGTACCCTAATCAAATGCTCTGCCATTCTTGTGACTCTACTTTTTCCA
CCCCTCCTATATGAAGACATCACACCTCAGTAGGGTGGACTGAAGTTTTCTCTTCATAAC
CTGCTGGTTGCTGCCCTGAATAGATCTTTGCTTGAGAATGGTCACTCCCTGAGTCCTTTG
TCAAATCTAACAGTAGCCAGTCCAAATGTTACTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved