Tupaia_belangeri Locus Mono:183:SNORD89
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:183:SNORD89
Tupaia_belangeri
Mono:183:SNORD89
GeneScaffold_421
SNORD89
1001..1115
2115
GCGCTGGCCAGACAGACAGAGACAGAAAGCGAGAAATCACCCCTTGGGGATTATGGCCA
CGTTGCAGTGCCTTCTCCTCCACTCTCCTCTCGGAATCTTGGGCACGCATGCACATGTGC
CCGGCATGAATTTTAAGCCACTAGGTCTGGGACTCAAACTGCAGTTGACTACGTGGGAGT
CCAGCAACATAGCCATTACGCTAACTGCTGGTCCCAAGGTAAGTCCTTTTTGATAATTAC
AGAAATGTGATTTCTTTATCTGCTATCAAATACATGTCTTTTTTTTTTTAGATGGAGAAA
GCACCACACCACAGTCTCTTCTCTATATCTCCATGCTGTGGGTACTTTGGGCACACAGAT
ATGCACCCAGCATGTTTTTCAAGCTGCAGAGGCTGAGATTTGAACCACATGGTTGGCCAT
GTGGGATCCAGCTCATTAAACACTAGGACATGGCACTGGCTCCAAATAGGTTTTTCTTAA
TTCAAAAATTTGAACACTAAATTATAAATAAAATAAGTTAGTAAATGAGTCTTAGCTCTA
GAAACAGAAGGGTTTTTCTTGTTGGTTTTTTGGATTATTTTTTTTAAGAAAGATTTTTGC
TATAGGGTGTGTGCACTCACCAGACAGACAGAGAGACAGAAGAGGAGAAATCACTCCCTG
GGAGGATGGCCATGCCACAATCCCTTCTCCTCCATTCTCCTCTGAGGACTTTGGGCATGC
CTGGCGTGAATTTTAAGCTGCCAGGTCCAGACTCAAACTGCAGTCAAATACATGAGAGTC
CAGTGACATAATCATTATGACATCTGCTGGTCCCCAAAACATAAGTTTTTTTTTTTTTTT
TTTTGAGAGGTTTGGTGCTATAGGGCATGTGTGCTCGCCAGAAAGACAGAGACANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAGCTGCTGAGGAATGATGACAAT
AAAAGGGCCGAATTGCAGTGTGTCCTATAGCAGTTTGCTCTCTCTGGGCACACGATGACA
AAATCTCCTGAAGCGAATCTCTGGTCTGACCTCAGTAACGGGTTGGAAGTTCATGCCACA
GGAAAGCTTTCCCAATGGGGCATTCCTACAGCTGCACTATTTCTTTTTAAGCTTTTTTTC
CATAGGGCACATGCACTTGCTGGAGAGAGACAGTAAAGGAAAGTGAGAAATCCCACCCAC
CTCGTGGGCATGGCCACTTCTCCCTTCTCCATTGTCCTCTCAGGACTTTGTGCACATATA
CACATGTCCCTGGTGTGGTTCTCAAGCTACTGGGTCAGGGACCAGAACTGCATTTGCCCC
TGTGGACGTCCAGTGCTTTTAACCACCACACTACTTGCAGTCCTCAGCAGCATTCTTTGT
GAGAAAAAATACTCAGTGATCCTCAGACAACGGTGGGGCTTAAGTGGATAGTAAATAACT
GTGTACCGTAAGGTAAACTTAGCAGATCAAGAACTGCTAGTCATACAGAAAATAATAGAC
CTTCAGGGACAGGTGTGTGCCCATTAGATGAAATAACCAGTGTAACCAAGTTCCCAGTAA
GATAGCCTCGTTGGCAAGTCTCTTTTGAGCACATTATTTCCTCAATGAAGACCGAAACCC
ACGTGGATTAACTAGAACTTGGAGTGAGTATCTAGTCTAAAGCGTTTTCTGTGGGTTCAG
TGATTTACTGAAGCACAGGATGTTGGCTTGAACCAAAGCTAGTTTTACAAGGTGCTGCTG
TGACTCAGCATGTGTGCAAAGCCATCTACACTTTTTCCAGCTAGTTTATTTTCCAAAGAT
TTACAAGTATCTGTCAGCATTTCATTTTCAAAAATAGTAGTATTTGGATGACTGGTTACA
AAAGTAAGATTTCTACAATGTCATAATCAGCCATGCAACTAGAGATTTGCCCTCTTTAAA
ACTAGAGCAAAGCATAAATTGTGAATTGAAAGGGTATTTGCATTCCTTTCATTTAGAGTT
CATTCCTTTCAGTTGTAGGCTTGGTGATGGGCTGATGGGAAACTTGGGCCCGGCAGTACT
TCCTGTGAACTGACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved