Tupaia_belangeri Locus Mono:98:SNORA36
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:98:SNORA36
Tupaia_belangeri
Mono:98:SNORA36
scaffold_117390
SNORA36
1001..1121
2121
GTAGTCAACCATGGTTAGAGTTTCGAACCCAGTGGCTTAAACTCATGCCAGGCACGTGT
GTGTGCATACCCAAAATCCTGAGAGGAGAATGGAGAAAGCATTGCGGCGTGGCCATCCCT
TCTGGGGGGTGATTTCTCACTTTCTGTCTCTCTGTCTCTCTCTGTCTTTCTGGCGAGCGC
ACATACCCTACAGCAAAAACCTCTCAAAAAAATCTATAATTAAAATTATCATCAATATGG
TGAAATCATGAAAGCTTTCTAAGATCAGGCATGCAAAAAGAATGCCTACTGTCACTGACT
ATCTGTCCCAGAGGTCTTAGACAATACAATAAGACAAGAAGAGTGGAAATGGGAATAAAA
ATTAAAAGAGAAACAAAAAATCCATTATTTGCAGATGGTATAATTGTTTATATAGAAAAT
CCAACATGATCTACAGACAATACAATGGAACTAGTAAGTGAATTTAGTGAAGTCAATGAA
TGCCACATCTATTTAATTTGAGTTGCGCTCTACTAAATTAAATTCAATTGTATTTACTAG
CAATAAATAAATAGAAAATTATACATATGTATATTATAATAAAAATTTAAATATACAACT
AAGGAATAAGTCCAGTGAGAATAGGATATGCTATCTTTATTAAGAGATCTGTTATTGTAA
ACAGATCAATTCTTCCAAACTAAGCTATTACTTGATACAATCTCAAACAAAATTTTACCT
GATTTTTTAAACAAATTGAAGAATTGTAGAAATTATATGGAAATACAATAGTCAAAGAAC
AATTAAGACAGTCTTGAAAAAGAATAAAACTAGAAGACTCACCCAAGACTTATTGTATTA
TATTTATAGCTATAATAATAAAGCACTATGCTATTAGTATAGGAATAAACAAATAATCAA
TGAAACATTAAAGGGATTCTAGATAGAGATCCACACAAATACTATCATCTGATTTATGAT
GCTGCTGAGCAGAAGGTAAAGCTGGACTCTACAATAAATGATTCCTAAGTGTTGAGTTCA
GTTCAGGGCAGCATATCTGTTCCACTTTGAGATGTCGAAATGGGCTGGGGAGATGACTGA
ATAGAAAGTATTACTCTATCATTTACTTTCCAACCTACAAAAAAAAAAAAAAAGGCAGAG
CAATTCAGTAACCATACTAGATAAAAGTAAAATCATGACCTCTAGTACACAGCATTCTCA
ATCATCTATTCCAAATGAATTATATATTTTAAAGTTGCAATAAAGCTTTTTAGAAGAAAA
CATAATTGAACAAATTCATGAGTACAGACTAAGCAGAGGGTTTTTTTTAAGTATATTAAA
TTTTTTAAGGGTATAAACATGCTAACCACAAAGGAGAAAAAATGTGATGAATTGGATTAT
ATTTATACTGAAAAGTTTTTCTGTTCACGAAAAGATAAAATTCAGACAATAAAAAAGCAA
GTGACATGTTTGGAGCAGTAGTTACAGTTGATAAATATTTGCATCAAACCTAAAACAATC
TCACAAATAATAAGAAACGGAATTAATAGAAAAAAATGTGCAAAAGACTTGAAATAGAAT
TTCAAAAAGAGAATTCTCAATTTAGCCCATAAATGTATGGAAAACTGTTCTATTTCTGTT
GTCAATCAAGAAAAGACAAATAACAGGGACCAGCAGATGGCATAATGGCTACGTCTCTGG
ATTCCCATGTAGTAGACTGCAGTTTGAGTCCCGGACCCAGTGGCTTAAATGCATACCAGC
CACATGTGCGTGTGTGCCCAAGATCCCGAGAGGATGCTGGAGGAGAAGGTATTGCGATGT
GGCCATCCCCCCGGGGACTGATTTTTCACTTTCTATCTCTCTGTCTCTCTGTCCTTCTGG
CAAATGTATGCTCCCAATAGCAAAAACCTCTTAAAGAAAAAAAAAAAAAAGGGAAAGAAA
AAAGAAAGAAAAGGCAAATAAAAGCCCAATGCAATATCACAACATGCCCACGACTAGTCA
CTAAAATGAAATAATAAGTAAAACAGATAATATCAAGTACTTGTGATTATTAGGAGCATC
TGGAAATTTCATTCACTGGCATCATGAGTATAATTGGAAGCACTTTGGAGAACTGATTAG
TAGCAACTAATAAAGTTGAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved