Tupaia_belangeri Locus Mono:70:SNORA51
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:70:SNORA51
Tupaia_belangeri
Mono:70:SNORA51
scaffold_123771
SNORA51
1001..1131
2131
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTATCACGTTGAAGAGTTTATACCTAACTGGGAAGACGAAAAGAAAGTTTCGTC
ATAGGGAATGAAATAGTACCATTTGATGTAAAAGAGTTTCAGACCTTCCAGTGCTTACCA
CAGGCTGTATTCCTACACTGATCATACAGAAAGAAGCAGCAGGGTAAACCTATTCTATAA
ACACCTCAGCCCAGGCCCTGTGCCTAACCTGTATCGTGAAGGGGAGACATGGAACTGAGA
GTTTCATTTCAGACAGTTGGAGTGGAGGATACAAATCATTTTCTGAAATAAATAAATACA
TACATACATATATACATACCTCATGCTGAGACTTAAGGAATATATAGGAATTAGTTAGAT
ATTTGAGTGATAAGTTTGGAGATACTCCAAAAAGGAGAATTAAGGCACCCAGAAGAATGA
AGTCAAGATGTAGCCCAAAGGATGCAGCAATTTATAGGCAGGTAAGCACTGGTAGAGCGT
AACATGCAAGGGAGACTATAACAAGTTGGTGGCAGCAAGAAGGAAGCATTGAGAAGGAGG
TCACATCTCCTCACCACAGTGAGGAACCTAGATAACAGTCCACGGGAGACAGGCAGCCAA
TGAAAGGTTTGGGGGGTCTTATCAGAGAATAAATCATGTTCTTTGATCTGGGATTTCCTT
TAAATAAACTTCTGATGCCTCTTTTTTCTCACTCATTACTCACTACTTCCCACTGGGAGT
CAATGGAGTGACCTAATTAACAAGTTTGAGGGAAATTGATCTATCACTTTGAGATTATCT
CTCGGGTATATCTCTGCCTTTTGAGAGGGTGTCTTCTGGTCTGTCCTCTGCCGAGTGGTT
AGCTTAGAAGGAAAACCTTTGACGCTGTGAGGGAGACCTGACTGCTTAGCTGTGCTGATG
ACTGGATCCAGCTGTCTCACTAATTTAGAGGAGAGTGTTAACATGTCATTTTACTCTGTA
GATGAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved