Tupaia_belangeri Locus Poly:8:SNORA71
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:8:SNORA71
Tupaia_belangeri
Poly:8:SNORA71
scaffold_130886
SNORA71, SNORA71
1001..1133, 2096..2229
3229
ATGTGAGGGTCTCCATCCTGCCAGGGAGCAGCTGGACATCGTGTCCCCAAAGTGAGGTG
ATCCTCTGGAGGTCTGTGACTGAGTCCCACAAGGCTGCATGCAGGTTCCCTGTGCATGGT
GTAGTCTGGGAAGGCGATACAGGTGAGATGATGGAGGCTTCATCTTGGCCCCACTGAGGC
CTTTGACAACTCTCAATGTGCTAGTTTGCAGTTTCTGAGAGTCTTCTTAGATTCCTTTCT
TTCTTCTTTTTTTAAATTTATTCATTTATTTATTTATTTTATGTAAAGAGAGATTTTTGC
TATAGGGTACATGCGCTCGCCAGCAGAGACAGAAAGAGAGAAATCACTCAACTGAGGGGA
TGTCCACACCACAATCCCTTCTCCTCCATTCTCCTCTCAGGAGTTTGGGCACACACACAC
ACACATACCTGGTGTGAGTTTTTAAGCCACCTGGTCTGGGATTTGAACCACAGTTGACTA
CATGGGAGTCCAGTGATGTAACCATTACACCCTCTACTGGTCTCTGTGATATCTTTTTTA
CACTGGCATGTTGGCAGCAGAATGAAAGATTTTGGCACCAAATCCACTTGTACCCAGGTC
TTTAATACTTCATTGTCACCTCCTAGCTTTGAGACCTTCTCTTATCCTCAGTTTCATCTT
CTGGAAAAGCAGGAATACAGACTATTTTTCTCAGTCAGGTTGTTTTCTACAACCTAAGAA
CTCTGTCAGTTTCCTTCTAGAGGTGCCTTCCCTTTGCTTCTCCTGGTTGGGGCACATTAA
AGGAATTTTCATGGGATTAGAAGCAATTGCCCAGTCCTTGTGCTCAGTTGGGCTGACTGC
TCCAAGCTTCTGCCATTGTCCTCCTTATTCTCTATACATAGTCCATCCTGGCTCCTATAT
CCCCTACAGTGTCTGACACCTGACACAGACACAGCCTGGTCTCTGCTAGCAGGAGGCCAG
GCTGACTCACCTCCTTTCAGCCAGCCTCCATCCTTTTCTGTCCTTGCATTCGTAAGTGAT
CATGGGCTGCCGGTGTCCTGGTCATTGGTAGTGCAGGCAGAGGAAATGGGAAAGGGTTGC
CCCGTGTTAGGAGGGTCCATGTATTTGCCTTTCAGTTCTGAGCGCTTTCTCATACCTGCT
TCTCAGCTCTGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTATGTATGACAGAGACACTGTCCTGCTTTTTTAAGAGAGATTTTGCTATAG
CAGTATGCTCACAGAGCACAGAGACAGAGAGAGAAAGTGAGAAATCACCCCTGGGGGGGG
AGTGGCCATGCCACAGTCCCTTCTCCTCTGTTCTCTTGGGATTTTGGACATGCTTGCACA
CGCTCCCAGCATGAGTTTCAAGCCGCTGGGTCCGGGACTCAAACCGCAGTCAGAGTCCAA
CATACAACCACTGTGCCACTTGCTGGTCCCTGTGGTCCTTGGCTTTGAACTCCATCTGCC
ACTATCCCAGTCAGTGACTGATTCAGAGCCTAATTCTCTTCCTTTGAGAAAGTTAGAATC
AAGGTGTCTTTTATTGTACTGAGACCACATGATCTCTGTCATCACCACCCCTAATATTTC
TCAGTGTGTTTGTCCAAAGTGACTTCTCTTGTTTCCACTGGCAGGGAGTTTCTGTGTACT
TTTACAGGGAAGAAGGGCCACTGCTGGGGTCCTGTGCTTGGCTGGGTTTTCTCAGGCTCA
GCCTATTCCGTAGGCCTCTGGCACCTGCCTCTCTTCTTGAACCTCTCTGCCCCTGTACCT
GCATTCAAAAGTGATCATGGGCTGCCTGTGCTCTGGTCGTCGACAATGCAGGGAGAAGAA
TTGCTGAAAGCCGTTTCCCGTGTTTGGAGGGTTCGCGCCTGTCCCTTTCAAATGCTGGCG
CTTTCACACACTGCTGTTTCTTTCCTGCCAGCACCTTCCACTCTCAGGGCATTGCCAGCT
GCTCTGTAAGAGTGGTGGGGCATGCATTGACATGGCCACCTGCTGTCAGAGACCAGGCTG
TGGTTGTGTCGAGTGTTAGATACTTTAGAGGGGGCTCAAGGAGCAAGGGTGGATTATATA
TAATGAGTAAGTGTGACGTGGGGTGGTATCCAGGCATTGCCATCAGATTTTCAGGGAAGT
GCCTTTCCGAAGTGGTAGGCCTGGGTCAGCCTTTGAGAAGCAGGATATAGTGGGCAACAG
GAAGGTATTCCAGGGAAGGGGTGCAACATGAGGATGACTTTGAGGCTGAGGCAAGCAAGG
GAGACAGGTGCAGGCCCATAAGAACAGCTGAAAGGGATAGTTCCTGAGGGATCCTTCACT
CCGCCAGGGTGCGGTGGTACTTGAGGGGAGGAGGCCTGAGAGTGAGGCTGGGAGGTCTCT
GCCAATATTCATCTGCTGGGTTGCCCTACAAGGGGCTGTTCTAGACTTCTAACAGCTATT
CTCTAAAAGTGTTGAGATTCTTTTTTGAGACGAATTTAGTATGGAAGAAAACTGGCAGCT
CATACCTGATCAGTTGGGGCATTCTCACTGATGCCAGCTTGAAGAAGGACAAGATGATAC
TAGGACCAAACATCTGCAGTAACCTCCTGCCCTTGATCTCCTCATCCTAGAGATGCTGCC
ATGGGCCTGGAGATTGCCAGTGGAAGTCCCAAGGGGATGGAGGCACTGACCCTCTCAGGA
TGGTGACCTGTGGTCTCAGCACCTCTAGAGGCTTCCTCGCGGTGAGTTTACACCAAGAGG
CTAAGTCAGCCTGGGTTTTGAGATGGGAACCCCAAGCCTTTGCCTCATGTGACTTTCTCT
CATAGGTTATTGGGGACCAACCATGGACTGGCTTAGCAAAGAGTGAGGAGCGATGTTGCC
ACGTGATGCGTGGCCAGACCTCCTTTCCCCTGTTGCCTCAGACCAGCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved