Tupaia_belangeri Locus Mono:86:SNORA9
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:86:SNORA9
Tupaia_belangeri
Mono:86:SNORA9
scaffold_110384
SNORA9
1001..1133
2133
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAATTAAAAA
AAAATAACAACTTTATGATGGGCCTTGTGCTCACATACCAAGGTGGACAGAGAGCACCCT
CACAGGATTCTGTCACCGTGAGATCCCTTTCCTCCAGTCTTCCAGCTTACCAGTGTCCTG
GGCACACATACACACACCACGCGTGTTTTTCAGGCAGACCAGGTGGAGAACTTGATATTG
GTTAGCATGTGGCTTCCAGCTGAGTAGTCTACTGCAGAGTGCACCACAGAGGCTGGTTCA
GTTCTTTGCAGCAGTGGGCTTCTAGAACCAAGTTCAGCCCCTTGGTCTCTTCATGCCTCA
GCACTCAGGATGCCTGGGGTTTGGGAGATTTGGGTGAATGGTAGCAAGCCTCCAGCGTGC
TTGGGTCTGTGGTGACCCTTTGCATTCCTACAGTGCTTGCCAAAGCAGTTTTGAAATGGT
TTGAGGCCTTGCCCTGCTCTTTCCAGAGCAAGGTTATAGAAATTTCAGACAATTTGCTTG
CTCCCTCCCAGACCTGATGTGCTGGGCATCATGTAAATTTGTACGGTTTGAGGTAGCAAC
CACAAATGGTTGGTTAAATATTAAATAATTGGGAAAGTCATGCCGTATTTTTCTACGCAA
AAATGCATCATGACTTGGGACCAGCAGTTGCTATGATGGCTATGGCACTGAATTCCCATG
TAGTCAACCGCAGTTTGAGTCCTGGACCCAGTGGCTTAAACTCACGCTGGGCGCGTGTGC
ATACATGCCCAAGATCCTGAGGAGAATGTAGGAGAAGGGATTGCGATGTGGCCATCCTCC
CGGGGCATGATTTCTCGCTGTCTCTCTGTCTCTCTCTGGCGAGCGCATGCGCCCTATAGA
AAACAAACAAACAAACAAATGCATCATGATTTTTCTGATGACCCAATAAACCTTAAAGGC
CAGCTGGTGGCCTTGTAGGGAGTTAAAGCATGTGAATCCCACATGGCCGACTGCACAGTT
TGTCCTGGACCTGGTGGCTTGGGAAAGAACACTGGGCGTGTGTTTATGCTTGGCCAAAAT
TTCAAATGTAGAAAGGATTGCAGCAAGACTACTCCACATAAAGGGTGGGGTCTGTTGTTG
CTTTTCCTTTGTCTCTGGCAGATACATGTGTCCTCCTTTTTTGTTTTTTTTTAATGAGCA
AAATTTGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved