Tupaia_belangeri Locus Mono:205:SNORA11
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:205:SNORA11
Tupaia_belangeri
Mono:205:SNORA11
GeneScaffold_3160
SNORA11
1001..1132
2132
GATCATACCATATTGGGGGTGCTGTCCCCGTCTCCCTTTCCCTTTCTCTCTCTCTTTGT
CTCTGTGAACACACACACCCTCTGGCAAAAAAAATAAAGACCACCAAAGTTATTGCTATA
GATATATTCTAATAATGAACACTTTCCTCATTACAAAAGTAATATGGGGGCCAGCAGATG
GTATAGCAGTTACATGACTAGACTCCCACATGGCTGACCAGGGTTCAAGTCCCAGACCTG
GTGGCTTGAAAAATCACACTGGGTGAAGGTGTGTGCATACTTAAGATCCCAGAATAGAGG
AAAAGGATTGAAGCACCTACCCCACCCCCCAGGGGTGATTTTTCACTTTCCCTCTGCATC
TTAAGGCAAAAACCTCTTTAAAAAAAGAAGGGAGGGGGGTGAGCTCATCATGAAGAAAAA
TAAAAAGGGAACACCAGCAAAGTAAAAGAAAAATGTCTTACAACACAATATTTCCTACAG
CTACCTAATCATTTGGAACATATTTCTGTTAAAGTATTGAACAGAAATTCAAGTATTGAA
AAAAGCTGCTCTAAGTATTTTAAAAATATACTTGATAAGGGCCAGCAAATGGTATAGCAG
TTATGTTGCTGGATTCCCATGTGGCCAACAGCAGTCTGAGTTCCAGATCCAGTGGCTTGA
AAACCACAACAGGCATATGTGCATACATGCCCAAGATCCTGGGAGGAGAATGGAGAAGGG
ATTGCAGCATGGCCATTCTCCCTGGGGGGTGATTTCCCACTTTCCCTCTCACTGTCTCTC
TCTCTCTCTCTCCTGCAAGTGCATGCACCCTAAGACAAAAACCAAAAACCTCATTTAAAA
AAAAAAGGTATATGAGCATGTAAAGAAAAAGCAAAAGGAACACCAGCAAAGGAGAAAGAA
AAATTGTGTATCAACCCAATACTCCCCTACATCTACCTAATCATTTGACATGTTTCTTGT
TCAAGGTATTTTGTTCTAAGTATTTAAAAATATTATGTAATGTGGCGTGCTCAGTGCAGG
GGGCCTAGAGAATGGCGGCTCATCTGCTTACAACACACCCAACAGGAATTTGAGGTCACT
GTGACAAGGGGCACAAAATGTGTGGCTTCCCTATGAACAAATGCCCTGTACATGAGGGGG
AAAAATACACACACACTCACACACACACACACACACGTACTTAATAAGGGCCAGCAGACA
GCGTAGTAGTTAAGTCCCTAGATTCCATATGACCAGCTGTGGTCCCTCACTTTCTCAGTC
ACTCTCTGGTGAGTGCACACGCCCTAAGGCAAAAACCTCTAAAAAAGAAAAAAAGTGTAT
ATATACTTGATAAATACTACACATAAAATTATATTTGGTTCTTTTCACTTAAAAGTCTAA
CATAAAGCATCATCTTGTATTAGTATTAATATAAATTTAACCATTTGCTAAGGTTTATAT
TATAAATCTTCCTGTTAACATATTTTTTACACTGCCATAAAAACTTACGCTATATTTAAA
TATAACCATGAGTGCACAAATGCCTTCTTAAACCCAACATATAAAATCCATAGATAAATT
AAGAACAGATTTAATATAAAGTTTACACCTGTACTTTATAGTTTACTTCATAAACTGGTA
ATCTTGTAATCACAAGAAGTAATGGTTACTGGGTCCAGCACGTGGCACAGTGGTTAAGGC
ACTGGACTCCTTCATAACCAACTGTGGTTCGAGTCCCAGACCTGGCTGGAGGCTTGAAAC
TCACACTAGGCACATCTGAATGCGGGCCCAAAATCCCAGGAAGAGAATGGAGAAGAAGGG
ATTGCAGCACGGCCACACCCTTTTGTGAGAGATGATTTCTCACTCTCCCTTTCACTGTCT
CTCTAGCTGTCTCTCTCCTCACCAGCAAGTACAAATTCCCTGTGGCAAAAAACGTAAAAT
AAAATAATAATGCAAGAGGAGTAATGGTTATTTTGTTTTCAAAATAAATAAAAATAGCAC
AATACCAAGGGCCTCCTTTTGAATCAAAATTTGAGTAATACTTGCCCCATCTATAAACTT
TACTCCTGCAGTGTAATAAACATGAGAAGTATATATCTACAAAATGACACAAGATTTCAT
CAGCACTGTGTGCACATCAAGTTCATCATGGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved