Tupaia_belangeri Locus Poly:6:SNORD113
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:6:SNORD113
Tupaia_belangeri
Poly:6:SNORD113
scaffold_146325
SNORD113, SNORD113, SNORD113
1001..1075, 3283..3360, 4955..5029
6029
GAGTGAAGGAGAGATAAAGCAAGCCCCTCCGACAGAGTGTCATCATTGTGATCCACCCC
AGCTTCAGCCTGTCCCATGTCATGGGCATGCAATGCTTGGAGTAGCCAGAGCGGTCTCTA
GGCTTGAATCCAGAGCCTTCCCTCTTGGGTCAGCCTCAAAGAGCATCACATTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCTCGTTCCTTGAATTTTGTGTTCATATTGTTACGAATGAACCATGA
ATAAATAAATGCATGAAGATATAAAGAAAGAAGAATGTGCTTGGACCAGTGATGAGTACC
ATGGGGTATCTGAACCAGGATTTTTGATTAAACCCATATACAACTCTGAGGTCCATTACA
GAGAGACACGTAATTATTCCTTCTTTGGGAAGTGAGCCTGTGGCACCTTTTCTTTGGGGT
TTTGTGGTTTGGGGGGAATGGATTACAAAAAGTATAATATAAAATTAACTCATGAATAAA
ATACCAATAAATGAATAAAGACAAACAATGTACTTACTATTAAAGAATGTCATGAGACAT
GGGCTTTGAGTAAACCTATCAGAGGCTCCCGATACCTTGATGATCACGGTGTTGACCAGG
CTGCTATGGGCATGTGGAATGCTTCTGTTCTGTGTTGGTGGTGATTGGTTTATCAAGGAA
ATGAAGCAGAATAATGCATATAAATCATTGAGTAGCAAGCAGAGACCAATGATGAATTTG
TTACTCCAATCCCTTTGTATTTTTTTTAACCAAGTTTTATTAAAACAATAATGAAGAGCA
ACTCTGTTGTTCTCAAGGACTGTGACTATGCACAGATATATTGTTCCGTATTCTTATTGA
GTTCTTTGAGATTACGTGTGCTGATGGCTTTGAGTACGAGAAAGAAGGCTTGATTTTATA
TCTCAGTTATCATTGTACCAGAGGGTACGTGTATGTGCAAGAGAGGCAGAGGGAGAGAGA
ATCTTCCAGAGGGGCTTGTTCATGCTATAACCCTTCTCTCCTCTGTCTCTATCCTTCAGG
ACCCTGGCCATGTGCACACATGCCTGGTGGGTTTTCCAAGCCACCGGGGTAAGATCTGAA
CTGTGGTTGGCCACATAGGATTCGGCTCTCTTTACGTAGCACCTAACCGTTGTGCTAGGA
GGCTGGCCCTATCTGTTTAAAAAAAAAATTCTTCCATGAGCAAGTGAGATAATGAAAGAA
ACAGAGAGATAGCACTTGTAACAGAGTCGTGACCCCATCATCACCCCCAGCTTCAGCTGG
CCCAGATTATGGCACATGGGTGTCTGAAGGTCTCCAGATGTGACCGTGGGACCTTCTCAT
GTAGGTAAGCCTCTTGTTTTAACACCGTGCCACCATCTAGTTCTTCTATTTGCTTATTTA
TGTTTAGGTTTTTGTCACAGGGCATATGCGATCACTGAAGAGAAATGGGGGGAGAAAGGG
CGAAATCACCCCACTGGTTTGGGGGTGATGGTCATGCCTTAAACCCTTCTCTTCCTCCCC
CTCCTCCTCCTCTCCCCTTAGGGCCCTGGGCATGCACATACACTTGCCCTGTGTGATCTT
CAGGCTTCTGAGTCCAGACTTGAAGCATGGTTTGCCATGTGGGAGTCCAAAGCCTTGCCA
CTGCTGGTGCATGACTAATTTTTAAAGTTACTGACCATGAACCAGTTAGGAACAGACATC
ATGAAAGGGATACTGGTTCATAGTTTTTTCCCATAAATAATAAATACAATAAATAATAAA
TACCATGAAATAAATAAAGAAAGAAATATTGGGACATGTTTTAAAAAATAGGCATTTTTT
TTCCCTATAGGATGAAAAACACCGTGATTGCATTATTCTCTAATCATGGAGACCCTTACT
GATACTTATGGACTAAGGAGCAAAAAGATTGATGTAAGTAAATATCAGAGTTGATGTTCT
GGGCTTGGATGGGGTTCTTTCATGGAACCCATTCTATTATTTTAATGAAATAAACAAATA
ATACATGAAGTGAAGGAATGTAAGGATGAACCCCTGATTGGAATGTGTCATGAACAAAAA
TTTATGATGACTTCAACTCAACCCACCTAAACCCATTACTACAGAAATGATGGCGTTTCC
CACATTAGGATAGTTTAGCTGATCTCTCCTGCCTTTGTTGTAGTTGCTTCATTGATTTCT
GCCTTGACAAGCATCTGTGTGGTTACCTTTATGAGGCAGGATTGTGATGGGCTGGAGCAG
GTCAGTGCTCTGGATTGTGGAGTAAGACAGTGGGTACATGACTGTTGATTACACCAGCTT
TGACAAACAGGAAGATTAAATGAAAGAGGAGCAGGGAGACACCAGTCATAAATAAGGAAT
TAACATGATGTGTGGGTACCGATTAGTCCAAATGTGAACTGGAGAGTCATTGTAAGTGAT
CTAGTCTATTTGCTGGTGTGAGGGGGGGCATGAACAGCTCTCGGTTCTGCTCAAGCATTT
TGTTCTCAATTTGGTGTCATTAAAAGGTATCGATTGTGTAATAATTATGCACGGATCCAT
GAGTGAGTGAATCAGGTCAAGAATGCAGAAGTGGAACAAAGCCTGGATCCGTGATGAGTC
CTGGTGGAGGTGTCTGAATCAACATCTTTGGTGAAGCCCTCTGTGTAACTCTGAGATCCA
TGACAGCATGAAAAGTAGCCAATCTTTTCTGTAGAAAGTACCTGATAGGAGAAGTTAGGA
AAGTTCAATAAATGTGTTGCTGGACTTTTGTAGTTCAAAGAAATGGAGCATCTGGGTTCA
AACAAATTAATGTGCAGACAAATAGAGACCCACGTACGGAGAGAGTCGCAGGCCGGCCGG
CTCGGGGCCGTCATCAGAGTGCAAGGAACAAGTATTGTTAGTGTTGGCCCTTGCGATAAA
ACAAGCCTAATTACTAGTCTGAAGTAAAGGAGTACAGAGACTCTGCTCATCTCTGATATA
GAGCACATTGGTTTCTGTAGTTAAGAGATAATTTTTTTGTTTTGGTAATTTTTTTAAATT
AAGAAAAGGGAAAGTGTTTGCATTAGCCAGTAAGCGATTAAATAACCATCTATTTAATAG
ATGCTTATATACACAGATATTTGTAATCATTATAGAACTTATTCTTGGTCTACATGGTAG
ACTCAATAGTTTTTATATATTTAACATTACAATTTTAATGCCAAATTAACTAAATGATTG
TAAGTGACAAAATGTATTGGTATCTAGCTCTGCTTGACTAACATCCACTAAGAAGATCTA
AATGTGTTATAAATCTGCCTTTTTCTCCCCAGGGTGAACATTGGAGAGCTGATATGGTCA
TTTAATAAAGAACTGTTACCCACGTAGGGAGCATGGACAGGAACGTAAGAAAACCCTTAG
TTTATGTTCTTTCTTTGAATGGCTCGTTCATGGCTGTTAGCTGAAGTTATAAATGTCCAC
ATACATAAAATAAACAAAATGCTCCTAGCGTGAATCAATACTGGGAACATGTTATGAACC
AAAAATTATGTTTAAGGTCAATTAGCATAACAAAACTGATTTTTTTTTTTAAAGAGAGAT
TTTTGCTATTTATGTGTTTGTTGGAGAGTCAGAGAGAGACAGAGACAGAAAGTGAGAAAT
CACCCCTCGGGGGTGGGGTGGCCATGCCCATAATCCCATCTACTCCATCTCCTCTGGGAA
TTTGGACACGCTTGCACCAGTGCCTGGTGAGTTTTAGCACTGATCTGGGACTGACACGCT
GTCGACTATGTAGATGTCCAGCGATGTACCATTATGCCATCTGCTGGTCCCCAACAAAAG
TGATTTTAAAAGACAATAGAAGTTATTTAATTTATTCTCAAAACAGTTTTATATTATTCT
TTCATTTATATCATGGCTGATTTCAGCATTCCCATACTGTTAGCAATACTGGCTTATAGC
TCTACTGAGGTGGTCTATAAAAATGTGGATGAACATTTCCAAGGTGATAGAAGATGGTGG
TGATATTATTTTTCATTGAGCCATCTTTGACCTATGGACAGATTAAATAACAAAGGCCCT
CAGAAGAACCAGTGCTGAACGCAGGTCTGAAAAGGCAGGGATCTGAGTTAAGCAGTCCAG
ACATCCATCTCTGATGCCATCACAAAGAAGCAGAGTCTGTAGGTCTTTAGCGTGAGAGCC
TAAAACTCAAGGATATTTTTTGGGGATTTTGGGATTGTACTATTATTTGTGACTAGATAT
ATTAATCAATAAATTTGGAAAACAAATGCCCACCATGGACCAGTGATGAATGTCATGGGG
TTTCTGAAAGAAGAATTTTGATTAAACCCATCTGCATCTCTGAGGTCCGCCATGAAGAGA
CGCCTATTATTTATTTCATAGGAAATAACTATAGAACCCTTGGCTTTTGTGGCTCAGGGG
TTTCAACTACGTTATTGTAGTAAAATTAGCCCATGAATAAAGAAACATATCAATGAATGA
AGAGTGAGAAAAGTATGCATGCACTTACTTTTGAAGGCATGCAACATAGATTATTATAAA
CAGAATTTTGGATTCTTATTCCCGGACAGTACTCAAGGCTCTGATCACTTGGGCGAAAAG
CAGAGGATCATCTGTACATTAGAGTGAATATTTTTGCTCTGTGTTGAGGTGGGAAACCGA
CTGACTGTTTTGTCAAGAAAAAGGAAATAAATTTTCTTAAATAAATGGTTGATTGAAAAA
ACATGTAGTTGAGAGAGAGTGCATGGAGCAATGAGACCTGTATACAATTATAATTTCGAT
TCATGAGATCTTTTTACGCAATTGTATTTAAGCGCATAGACACTAGATGAACCAGTCTGC
TACCTTTTTGGGCAATGACATGAGGGTAAACGTACAATAAATATTTCTCAGAGTACCTAC
GCAGTACCTACGCCATGTGGGTGAGCTCACATATATTGAAATGTACTTAGAAGGGAACAG
ATTCATAAATTTACATGTCAATCAGTTAAACATCTGGCAAACACTGTGTCAGTAGGAAGA
ATGCAATTGTGTATAAATATAATGATTCATTGTATTTCACTCAACTGCTATCCCTAGGAA
GACAGAGTCCTAGACTTTTTCAGTGGTGCGTATAGACATCTGCAAGGAATCGTGTTTTAG
TCCTTGGTTGTCTTAGTGGTTGTTACTATTCCATGAGGAATGAGTCAATTACTGTGTGAG
TTAATAGATTTCCTGAGTAGGGTCAAATTTGAACCATTGGTGATTTTGTATCATAAATTG
AATCTTCCATGTATTCAATTTTTCACAAATAAAAATTGTGAAAAAAAAAATTTCTTGCAG
ACAAGTCCAGGCAGATGGTCCTAATAATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved