Tupaia_belangeri Locus Mono:105:SNORA25
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:105:SNORA25
Tupaia_belangeri
Mono:105:SNORA25
scaffold_150724
SNORA25
1001..1124
2124
AGTGCTGGGCTTGGGCCACTTCAACGATTTTGTCAATTAGAAGGGCCCGCTCTAGGCCC
ATGGCACCTCAACGTCTTCTTAGAAATCTTGTACATTTCCCAGATTACGCAAGCCTTCAG
GCCCCCACCTCTGAAAACACACACACTGGAAAACTTCTGAATCTGGCTCCTGGCTCCTTC
CCTGACCAGGGAAACTTCATTTCCGTCTCTGTTAGGGATTAGCCACCATCTCATTCTGCT
ACTTTTAGTAGGATGTGGTCCTCTAAAATTCAACAGCTATTTTTAATCCTCTTTGCTCAC
TTCTTCTATACCTTATTCCTAGGAAAAGGCCACCTTCCTAGGAAGCAAATCTCCCCACTC
CCACGCCTTCCTATAGCGTAGTATCTCAAACACATGGTGTTTTTCCCACTCAGGTTAATT
TACACAGGGTAAAATATAGCCTTTTTAAAGAAAATAATTGCTACAGAGAGAGAGAAAGAG
GGAAACCGAGAAACCACCCCCCCAAGCCCTCCCCCACCCCACCCCCCACTCCCCACCCCC
AGCCAGAGAGAATGACCATGCTGCAATCCTTTTTCTTCCATTCCCCTCTCAGGATTTTGG
GCACACCCGTGCATACTCCCAGCATATTTCTCAAGTCACTGGGTCCACAACTTGAGCCAT
GCCGTTGGCCATGTGGGATCCAGGCACCTCAACAACCATGCGATAGCTGGCCCACATGCA
GCCTTTTTAATACACAGTTCTAGGATTTGTGACAAACACATATGATGTGTATCCACCACC
ACAAAAAAGTTACAAAAGAGTGCCATCACCCCAAGAGGTTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTTCAGAAAGTCAAATGACTCACATACATAAACAGATGAGA
CTTTGAAGGTCCAGAGAGAGAGAGTCAACAAAAGGGTCTATAGGTTATTTCAAAGACGTG
TTATGTGGTTATAAACCAAAGCTCTTAATGCTATGATCAAAGATGGAAGTTTTCCTGAAT
ATGCTATAGTCACTAATGGTGCTGTTTTCTTAAGGAGATATAAGACTTGGCCACTCATAC
TCATGACAGTTCACTCATAATAATCCTGATTGGTGATATGGGAAAACAAATAAATGCCTC
CAATTTTAAAAGAGAGAGAGAGAGAGTCTACCTCAAACCCCAATAATTCAGATTTCCCAC
ATCCAGTTTCCAAGACACCAGGTTGTACTTCATTTCCACGAGCTGTCCTATAACCATACA
ATAGCTACCTTCTTTATTTTGGCTTGCGTGAATGCTTTTCTGTCCCCTGTAACCAGGAAC
TCCATCCCCAAATGCCTTTATCTTCAGGTAATCTAATTTCATATATTATAAAAATGGTCA
CTCTCAAATCTCCAAGGGATGGCCTTGGAGTTGGTCGTGGTGGCTGCTTCAGTCTCCACA
GTTCCCATGACAATTATCCCTGGCAGAACAAAGACCATTAAGAAGCTGAACAAGAGGAGG
AAAAAGGAAAGCTTCACCTTTGTAACTACATATGAAGTTTCCTGGAGAAAATGAGCTCCG
GAGCTGAAAGAGAGGATCTAGTTAGAACTGGGGAAGTGTCTTTCATTGACTCGGGATGGC
CCCTAGAGAGAACACGCTGTGTTTCCTCAAGTAATTCCTTTACTCGTTCCATAAACATTT
ATCGTGCACAGATATGGGCCTGATCCTGGGCTTGGAAACAAGACATAGACGACATAATGT
CTTCTCATAGTTTAGTGAGGGAAACAAACATTTTAGCACTTTGTTGGTACTGCAAATAAG
ACTTTATTACGGTTTACTTTCATGAGAGTTATTATAATATTGAGATATTGAAATCTCAAT
ATTATAATAACTCTGACCTTTCGTATGAGATGAAGGATTCATAAAGAACAGGGACCCTGA
GTTATCATTTCTCTTTCCCTCCACTGAGACTAGTGTCAAGCCTGGCACTCAGAAAGTGAC
TGGAGAGATTAATGTCTCTGTACTGACGGACATGCATGGCATTCCCTTTTGAAAAAACAA
TGTAATACACTGTAAAGTTATATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved