Tupaia_belangeri Locus Mono:125:SNORD43
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:125:SNORD43
Tupaia_belangeri
Mono:125:SNORD43
GeneScaffold_3429
SNORD43
1001..1064
2064
TTTACTAGCAACATAATAGGCTAGACCATAAAGTAATGTTAATATCTCTAAAGAAAGGT
ACAGAATACTGTGGAATATAAGAAAGGAAGAACCCAATCTAGACTGGAGAGTCTAGGAAT
ACATTCTACAGTGTATTATACCCCATGTAGCATGTTGAAGGGCAAAAGGGAATGTGGTTG
GCCCTCATACAAATGAGAAATATGACTAGAAATTATCTATTTGTATTTTTCTAGGATACC
TGTTTGGGAGTAAGGTTAGAATTCCCACTTCTTCAAAGCTTCAAAATTAGACTGAAGAAT
ATAATATATCTATCAGGTAAAAAATGGACAGAGACAGAGAGAAGTAGCTTCAGAGTTGCA
TGATATTGAACCACTTGTAAACATAATAGTCATCTATTTGAAGAAACTAGTAAAGAAATG
TATTTTGCTTTCAAATCCAGAGAAACATTAATAAGAAATGAGGCCATTGGCCAGAAACAT
GACCTTAGAATCAACTTTGCCACTTATCTTGATTAATTATTTCTATAAAGCTCTTTGGCT
TCAGTTTCTTCATCTGTAACATAAAGATTGAAGAATCCCCACTCTCTGCCTTCCACAGGC
TACTGTGTGGGTCCATGTGTGTTTTGTAAACTCTGATGTGCTTTAGACTAAAATGAAATG
AAATCATAATGGTGTTAGTGATTATTTTCAAATAAAATAGAAACTAGGTATCATGGCAAG
ATATTCCTATTAAAAATAATATGGGGATCAGCAGTTGGCATAATGGCTATGTAGTCAACT
GCGGTTTGAGTCCTGGACCCGTGGTTTAAAGTCACACTGGGCCCGTGTGTGTGTGTGTGC
CCAAGATCCCGTGAGGAGAATGGAGAAGGGATTGCAGTGTGGCCATGACCCCTGGGGGGT
GATTTCTCACTTTCTGTCTCTCTGTCTCTCTCTTTCTGGTGAGCACATGCACCCTATAGC
AAAAATCTTTAAAAAAAATAGTAATATGACTTCTGGATCGTCACACATGATGAAGTTGTT
GATGGGTGGACAGAGACTATGTGCTGTGTTCTAATTTGGGGTGTGTGGGGGGCAAGACTA
CAGGGTCTCAAACTCTGCCTTGACAATATGTCCACCTGGCCAGGGCCAGGTCTTAGCTTG
GTTCAGCTTCTTGAGGAGAAACCTGCCATTTTCCAGGCTTATTTATCATGCTTTCCACAG
AGACACTTTCCAAACCAGAGGGTGATGTGTACTTCTGTCCCTTGCCAATGCTTGCTTGTC
TTTCTTGCTTGGTGTCTGGCCATTTATCCCTCTGATAAGAATGTGAGAGAATCTGTGTTT
TCCTTTTGCTTTTCTGCATGAGACAGGTTTGGGCAGAGAGTTGAGCATGCCTTGCCTGAC
AGATGTTTGGGATTTTTAAGTGAAAGGTATGTATAGTTCTTCATTTCATAACTATTTACT
GAGTGCCTAAAGAGAACCAAGAATTGTGCAAAGAAGCCATCAGACATTTTTGCACTCTTG
AGGTAGTTTATTTTTGGATAGAGATGCAATAGCTAAGGTACTGGGAAATCAGTACTCCAT
CAGAAGTCTTTGTTGAACCATCAGCTCATCATAGACGACATTTAACAAGTCTAACTATCA
AGTCACATACTTTTTTTTTAAGAGAGAGAATTTGCTATAGAGTGTGTGCAGTCTCTGGGG
AGACAGAGAGACAGAAAGTGAGAAATCATCTCCCAGGGGGATGGCCATGTTATATTCCCT
TCTCTTGCATTCTCCTCTTGGGATTTTGGGCACACACACCCAGTATGAGTTTTAAGCTGC
CGGGTCTGGGACTCAAACCATGGTTGACTACGTGGGAGTCCAGTGATGTAACTATTATGC
CATCTGCTGATCCCTCAAGTCATATACTAAATTGAGAACACTCTCATTCTTGGAAGCACT
TCCATAAAGGTGAAAGAAGGATCTCTAAAAATCTACACCTCCATGAAAGCAGGAGAACAT
CATTTAAAATAGTCAAAATTGAACTTTTAAAAACTCTGGAAAATACCCAAAGGCTTATAA
AAATCTCAGAAGAATTTTAGTAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved