Tupaia_belangeri Locus Mono:178:SNORA65
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:178:SNORA65
Tupaia_belangeri
Mono:178:SNORA65
GeneScaffold_932
SNORA65
1001..1126
2126
AGGGGGTGATTTCTCGCTTTCTGTCTCTCTGTCTGGCGAGCGCACGCGCCCTATAGTGA
AAATCTCTCCAAAAAAAAAAAAAAAAGATTGGCTATTATCAAAAACACAAACGATAACAA
GTGCTGGCAAAGATGTGGAGAGAAAAGGAACCCTTGTACAGTGTTGTGTGTATGTAAATT
AGTATAGCCAATTCAGAAAAACATATGGAGGTTCCTTAAAAATCTAAAAAATATAACAAT
TATTTGTAAAACAAATTATATCAAGGGGCCAACAGGTAGTGTGGAGGTTAAAGTGCTTGA
TCCCATAGAGTTGACTCCAGGGACCAGCAGTTAGCGTATGCTATGTCGCTGGACTCCCAC
GTAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGTGGTGTGGTAGTCAAGAGCTCTGGCTCCGACATGCC
TGACCGTGGTTTGAGTCCAGGACCTGGCAGTTACTTTCTCACTTTCCCTCTTCTCTCTCT
GTCCCTCTCTGACCAAATTTAAAATAAATAAATAAATAAATAAAGTTAAATAAAATGATT
CTTAAAAATATATATATATATCAAAAATTATTCCTCAGCCACCCGCCACTGCACCTGCCA
GCTGTGTTGGCTGGTGCAATCCAGTGGTGCGCTGATAGTAACCCCAGCTTAGGAAACAGG
GTTGTTCTTCATGTGGATGACTCTGTGCCGAAAGCGTGGGAACAGCCTGGAACCAGGGAG
GGAGGGCTTCATGCCATCTGCCCCGGCCTCAGGTTGTGGCAGATTAAAAAAAGAAAAAAA
AAAATTATTCCAAAATAAAAGATTTACTGGGAAAAGGGTCAAGAGGTGGTGTGGTGGTTA
AGGTGGCTGGATCCCACATGGCTGATTTCAAGGTTCAAGTTGTGGACTTGGTGGCTTAAG
AATCATGCCAGGTGCATGTGCTTGTGTGCCCAAAATCCAGAGAAGAGACTGGAGAAGAGA
TTGTGGTCGGGCCATCCCTCTTGGGGGGTGATTTCTACTTTCCTCTTTCTCTCTCTTTCT
ATCTCTCTGGTGAGCATATGCACCCTACAGCAAAAATAAAAGAAAAAACTGAAAAGAAAA
ATAAAAGACACATTTTTTAAAGAATTTTTTATTTAACTTTATTAATTGTATTTATTTATT
TATTTTAATTTGATTAGAGAGGGGCAGAGTGAAAGAAAGAGAGAGCAAGAGAAAGTGAGA
AAGCAAGACGCCAGGTCTAGGACTCAAACTATGGTGAGCCATGAAGGAGTCCAGCGTCCC
TATCCGCCACCTGCCAGCTCCCCAAAATTAAGATAATTTAAGGAATTCCAGCTAATGAAT
ATAGAAGAAATGGTAAAATTAAAAAATGGAACTTTGGGAGCCAGTAGATGGAAGGGGGTT
AAGGCAGCTAGACCTCACATGGCCAGCTGCACATTTCAAATCCCAGACCCAGCAGCCTGA
AAAATCACACCAGGCTCATGTGCATGCATGCCTAAAATTCTAAGGTGAGAAAAGAAGAGA
TAGGATTGTTGAGTGGCTATCCCCTCTGAGGAGTTGTTTCTCATTCTCTCTCTCTCTCTC
AGTCTATCTCCAAGGAGCACATGTGCTCTATAGCAAACAAAGACACAACTTCATTATCCC
TAACAAAATAACTGATTTGGGAAATAATAACAATAAATGAAAGCTTGAAGGAGAACTGGA
TTTTCACAGGATGTTAACATATCCCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved