Tupaia_belangeri Locus Mono:163:SNORA69
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:163:SNORA69
Tupaia_belangeri
Mono:163:SNORA69
GeneScaffold_1990
SNORA69
1001..1132
2132
AACGTTTCCCGCATGCCCTTTTCAGCCCATTGCTCTTCGAACCAGGTCGACCTTAAAAC
AGATCCTGAAGGGATGAAAAGTGAGCATCGATTAGTGATATTTGCCCAGTCCAGCAGTCA
GTGTCACTTGTATGTACAACAGCTTTCAGAAATTTGGTTTGTTTAAAATGCAGTACCAGG
TTTCCTGGCTCACTAGTAAACCATACCCAGAAGGCTGCAGAGGGAAAGTAAAAGGTAAAT
ATCACCAGAATTCTTACTCTGAAACCACCTTTATAGGCTGACATTTTAGGGTGAGCCTAG
TAAGTGGGTCTCTCAAAAGATGAAGAAAGACATTGAATTGAAGCTCAAGGGTGCACGATG
ACAATGTAAGCATAGAACTCTGAGTTGTACAGCAAACCTAGTGGGATTATAAGTCTCTTG
CTCTATGGTCTCACAGAAATGGGAAGATAAAGGTTTATTCATGATAGAGGGTATGCACCT
ACACACAGGAGAGAATAAAGAAGCACTTTTAAGTCTTGCCATGGAGCATGTGTACTCCCT
GGAAAAAGACAGAAAGCAAGAAATCACCCCCGGGGGGGATGGCCACGCCACAATCCCTTC
TACATTCTCTTCTCGGTATCTTGGGCACGGCACACGTGCCCCGCATGAGTTTAATTCACC
AGGTCCGGGACTCAAACTGTGGTCAACTACGTGGGAGTCCAGCGACATAGCCATTATACT
AACTGCTGGTGTAATCTTACTGCAATCCCCTTTCCCCAGCTCTTCAGTGTATCAGGATCT
TGAGCTCCCTGGCATGTTTCGAGGCTGGCCCGGGAATCTGTAGCACAGTGGGCCATGTGG
CTTCTAGCACCGACTACACCTCCAGCCCAGGCCACGTAGTTTTTTCATCGTTGCATCTTC
TGTAACCTTAATTGGATGCGCCCATACACCCTTAGTCAGAGAATTCACACAGAATGGTGT
TTTTGTTGTCTCAGCCCTCATTCCACTTTTAAAATACACCGAAAGCAGGTTGCAATTACA
GTGCTTCATTTTGTGGAAGTACTGCCATTATCCTGCTGAAAGAAAAGCTGTGTTGATCGT
TATTGATTTTGCCCATATGGGGGTAAAATCAGGACAGATTGGCATGGACAATTCTGAGAT
TGTTTTAGCTCTGCAAATCACTTTTACTCTGGGGTAGACATAGTGGGGTGTTAATGTAAT
GTGACATTATACAGAAACTTAGGTGTGTGTCTGGTGGAGCAGGGGCATTCTGTCCCTGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved