Tupaia_belangeri Locus Mono:150:SNORD58
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:150:SNORD58
Tupaia_belangeri
Mono:150:SNORD58
GeneScaffold_1670
SNORD58
1001..1066
2066
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTGCCTCTG
GCCCTTGCTCTGGATGCCCATGTCCAGGAGGATATGACAAGTCCCAGGGCCCTAGCTAGA
AAGACGATGTGAGCGCCGTGGCTCACCCAGTCCCATGGTCGGGATACCGTGCACTCTGCA
CGTTCCTGGGTGACATATGTGTCCACAGAGGCAGAAGTGGGGAGCGCTACCAGAACTGCA
TGGCTAAGAATGAGAGGAAGAAAGATGTGAAACGGACCTTAAGAAGAAAAAAAGAAAGAA
AATCAAACAAAACACACAAAGGTATCTTCCTAGTCTCTGAGCTTCCAGGCTTGTCCCACA
ACAAGGTGTCCTGTAGGCCGCTGACTACGGAAGGTGCGAATACGCCAGACTGACGTGGAA
GATCGAGCCTATGATCAGGCTGGCTGAGGCTGGGAGTGTCTCGCTGCATCAAGATTCTTT
TGGGCGTGATTTCGCTCTCCCTTTCTCTCCCGTTCTCCGTCTCCCTCATGGAAGAACTAA
GTTCAACTTTGAAAAAAAATGTTAATGAAAAAATAGTATTACTGCAATAATGGCACTTCT
TAAGATACATTTGAAATCATCATGAAAACAACTACTCTCTGAGTAGCTAATAAAAAAATG
GAATTAAAGTACTAGTAAATTTTTGGTGCAATTTTTTTTAAAAAAACTGAATATAGGTTT
TTTAAAATACGCATTTTCATTTTAAAGATACTTTTATGTTGGGACCAGCAGTTAGCATAA
TGGCTATGTCTCTGGACTCCCACGTAGTCGACTGTGGTTCGAGTCCCGGATTCAGTGGCT
TAAACTCATGCCGGGCGCGTGTGTGCGTGCCCAAGATCCCGAGAGGAGAATGGAGGAGAA
GGGATTGCGGCATGGCCACCCCCCCTGGGGGGTGATTTCTCGCTTTCTGTCTCTCTGTCT
CTGTCTCTCTGGCACGCGCCCTATAGCAAAAAACCTCTCAAAAAAAAGAAAAAAAAAAAA
AAGGGCTGCTGATTGCTAGGCACTTCCTGAGGGTGCTGATACACATGATAACATTGAATT
CTCACCATAATCATCTAAGGGGAGGCACAATTTTTGTTGTTTCTTGTTTTAAAAAGTTTT
GTGGCACCAGCAGAGGGCACAATGGTTACGTCGCTGGACTCCCACGTGCTTGACTACAGT
TTGACTCCCAGACTTTAAGACCTGGCGGCTTAAAACTCACGCCTGGTGCGTGTGCATGCG
GGTCTAAAATTCCGGGAGAAGAATGGAGGAGAAGGGATCGTGACGTGGTCATTCCCCCCT
TGGGGGTGATTTCTCACTCTCTGTCTCTGGCTCTCTGTTTCTCCAGCAAGTGCACATTCT
CTATAGCAAAAAGTCTCAAAAGGTTTTCAGGCTGGCAGGTGGCGTGGTGGTTAAGGTGTT
GGACCCCCACATGGCTGACTGCAGTTCAAGTCCCAGACCCTGCAGCTTGCTTTCTCACTT
TCCTGCTTTCGCTCACTCTGTCCCTCTCTGGTCAAATTAGACAAATAAATACATTAAAAG
TTAAGATAAAATACTTCTTTAAACATTTTGCAGGGCCAGCAGGTGGTGTGATGGTAGGAC
ACTGGACTCCCACACGGCAGACCGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved