Tupaia_belangeri Locus Mono:90:SNORD44
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:90:SNORD44
Tupaia_belangeri
Mono:90:SNORD44
scaffold_128517
SNORD44
1001..1061
2061
GGGGCAGTGTCACAGTGCTAGCTATGGGCTGTGAGCATCTAGAGAAGGAAGCAATGAGT
TTGTCACATGCTTTATTGTAAAATACTTCCTTATGTTACGACAGTGATTCTCGGTAATCC
TATGAGATTGGGATTATGATAATAGCCCTTTAAAGATAAGGAATTGAGAGCAGAGACTAG
CTGGTTCACCCTTGTACTTCTAGTGCTTTCATATAACCTGTTATTTCTTTGTTCATTCAC
TTAATAAACGCCCTTGAAGCCTACTATGTGCCAGGCCCAGTACTAGGCCCTGGGAGAATA
GTAGCTACAGTCCCACTTTCAGGGAGGTTACAGGAGATTACAGTAGAAATACAAACAGAG
GTTAATCACACAAACACATGTATAATTATAAACTGAGTCATTCACTGAAAGAAAACAACA
AGATGGGGGCTGACCCCATAGCCTAGTGTTTAGGGGAGCCAAATCCCACCTGGCCAAAGG
TTCAAGTCCCAGCCCTTGCAACTTGAAAAACATGCCAGGTATGTACACATGCATGCCCAA
CATCCTGACAGGATGGAGAAGAAGGGATAGTGGCATGACCACACCCCACATGGAGGATTC
TTTCTCCCTCTCTCTTGTCCGAGGAAGTGTACAAACCCTCTGGAAAATTTAGAAGAAGAA
ACTACTAAGATGTAATAGAGAAATTTCATCTTGTCTAGGACATCAGAAAGGACTTCCCTA
TAAAAATGACATTTGAACTGATTTTTAAAAATGTGAATAGACACTGACATGGTGAGGGGG
GATGGAAGTAGAGGTAGGGCAGGAAGAGACCGTTTCACAAGGAGTGAAAGTGTGTGCAAG
GGCCCTTAGTGGGAGGTACTTTGGTACTTGGAAGGCACTTAGAGAGGGCCAGTGATGCAT
AAGAAGGCTGTGCTGGGCAGCAGTCAGATTGTGAGGGACTTTCCAAGCTATGTTAGTGAC
TTGGTCTTAATCCTAAGAGTACAAGGAGCTATCAGAAGTCTTCAGGATGGTGATAAGCAA
CTTCTGACTAAACAAGAAGGTCTTAATCACCTCTAACTGATTTAAAAAAGAAAAAAAGGT
CTTTGACATAATCAAATTTGAAATTTATTGAACTCACTCTGGCCACACCGTTGAGAAGGA
GGCGAGGCCGGTAGAGGTAGATGTGGAGAGCTCATTTAGAAGTATCTTGCAATAGCTGTG
GCCAGTAATGATAGTATCTTGTACAGCAATGGAGCTGAAGGAGAGTATAAGGGCTCAAGA
GATGCTAAGATAGTTAAAATCAACAGGCCATGGTGACTGATTGAGTGGAAGCTGAGGAAG
AGAGTGCCTGGATGCCTTTTGAGTTCATGGCTTTTGGATTTGATTGGATAGGGGTACCCT
TCTATAAAAGTAGCAGATGCTGGAAGAGACCAGTTTTGGTGTGGAGATTGTGAATTCAAT
TTTAACATGTTTAATTGAATGCGCTTTTGGGGAAACTAAGTGGGGTAAGTTAAGTTGGAA
GCTGAATTCACAGGTCTGAAACTGAGAGGGTGGTCTGGACTAGAGAAAGAAGTTTGGGCA
TCGTTGGGTTATAGAAATCGTCAAAGCTTTGGGTGGGGATAGATTGACCCTGGAAAGTGG
GTAAGAAGGGAAATGAGGGTGCATCTAGCCTTAAGGCCTGCAACATCTAATGGATGAGTA
GAAGATGATAACTCTGCCACAGGCACAGTAAGAGAGAGCAAGAGGAAGATACAAGGAAGC
AGAAACTACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved