Tupaia_belangeri Locus Mono:59:SNORA35
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:59:SNORA35
Tupaia_belangeri
Mono:59:SNORA35
scaffold_148719
SNORA35
1001..1128
2128
CAGGGTTAAAATTAACCTTGTTCTGTGTTCTTGAGGTCAGACTATTATTAGAATTCAGG
AATGGCTAAGCAGCCTGTGGGCATCATTTGGTAAGGAAGCACACTGGACTTGGACAAAAG
GGAGTAGAGAGAAAGGCTTGTTTTGATGGGAACACTATTAATTTAGAATAGTGCTTGGTT
CATAAAGTTTTAGCAATGACTTAATGACCTAATGGAGCAAAAAATTAAGGAAGAAATAAT
GACTCCTTGCCAGTGGCTTCTTGAGGTGGCAGAATTTCCATCTTAACCAAGATTTAAAAT
GGGAGGCCCATCAAATAGTTTTCTGTTTTATACATTTGGGAGAATGTGAGTTCCTTCCAG
ATGCATGGGAAAGATGTGTCATTGCCTTTCACATAATTCAATCATAATGCTCTACACATA
CCTGTCAGGAAATGTTAGGCAATTTGAAATAGTCAAGCCAACATAAACAAGCAGGTATAA
AGCAACCTTGTTTTTGCAAGAGGAAAATATTGTTACAAGAGTAGAGAGTGTAGAATTATT
AACTTGAAAAAAATCCCCAAATTTGTAACCAGTTTTCTCACAAATGGTAGTTTATAAAAG
AGAATTGCCATTGGTGAATGAGAAGATGTTTAGTTGTGGCAGTAGCTATTATTTATTGAA
CTAATGTCAGGTACTGCATTGGACTTTCGAAGTTATTTCTTCTGATTCTCACAATAATCA
ATGAAGTAGTCACCAGTGATCACATTTAGTATTCTGAAGAAACAGAGACCACAAGGGCTT
GACTAAGCTTTCCATAATCCCACAGCTAGTCAGTGACAGAGATGGGATTCTGAACCTAGG
CCTGCCTGATTACAAACTCACATTTCCTTCATCTGAGCTTGCTCCATGTATGTAGTCAAA
ATCTGGGTGTATGAAGCATGGATTCTCAGATATTTCCATTCCCCTACCCACCCCCTCCTC
CACACTAGTTCCTCTGGTTCCAATCCTGACTCTGCTGTCTAAAGCACTGGCAAGTGACCC
ATTGGGCTCCCTCTTGACCAACTGGGCATCGAGCAGTGCAAAAGCAAATCCCTCCAAAAG
CTGGGAGAGTCACACTGTGGGCTACTCCTGCATGCAGGTGGGTACATGTGTCCTGGGTCC
TGTGACCCTGCCCAAGATATATGAGGAGATGGAGAGAAAAATCAAGCAGCTCCGTGACTG
CTATTACTAGATAGAGCTAACTATGTCCTTACCAGGTTAATAAAGATGCTCAGTAAATAT
TATCCTATTACATTATTATTATCATTACCAGCTAAGAAGCTCTCAACAACTTACATTAAC
ACCTCTTAGACTCAGTCTCCCTGGCTCATAAAATAAGGTTGACACTACTGGAATGATCTA
AGATCGTCATGGTGATTACATGGCAACATAAGCTCATTTCAATTTCCTGGAAAATTGCTC
ATTAAGTGTTACTAGTAAGAGAGATAATAGAGAACAAAGTGGTTTTCGCCTTCTGATGTG
ATAAAGATGACATTATAATTATCTGGCAGATGTTGGCTCCAGTGTATTGTTATTGGCCCC
ACATTCCCACTAGCTTTCTGACACTACCTTTCCCAGTCCATTCATTCCCTGTGTATAAAC
AGTAGGCTTAGACTTAGTGCTGACAGAATTCACTTCCTTCTTTTTTCTTGCCTAGAGTTA
GGTCCATTTCTGGCCCCTTCTTTCCTTCATGATACCTTTGAATAATCAAGTCTACTAATC
ACTCCCTCTACCACATAGTTTGACATTGATCAATTTCTCCTATTTTCAGTATTCATTTAC
CTTGTTATGTTATTAGCTAATTGGTAAACTCTTTGAAGGCAGAGGTTTGTCTTCTCATAC
ATAGTACCTACTGCAGTCTCTTGCCCAGGGCCTTGTATAAAGTAGAAACTCATTAAATAA
TTATTGCTGGGTAAATTCATGTAAGTTATCTACAAAAAGTCAGTCATCAATTTTTTAACT
AGAGCTAGAGGAACGCTCTATGCCATAGTTTTAACTCCAGGCACTGTTTTTCACGGCAAA
TAAAAAACAGATTAAAAACTCATTTGAGAGCCAGCCAGTGGCATGGTACTTAAGGTGGCT
GGATTCCCACGTAACCAACTATGCAGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved