Tupaia_belangeri Locus Mono:32:SNORD29
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:32:SNORD29
Tupaia_belangeri
Mono:32:SNORD29
scaffold_2620
SNORD29
1001..1063
2063
GATTCTATCTTCTAAGTGTTTGCTGAGTAATTGCTTACCGTAGGATTCTGGTATATGTC
TATTTTTCTAAGAATAAGCCTTCTGTAAGTTGGGTCATTGATTGATTGATTGATTGATTG
TTTTTTGGAGAAGTTTTTGCTATAGGGTGTGTGCGCTCACCAGACAGACAGAGACAGAGA
GACAGAAAGTGAGAAATCACCCCCCAGAGGGGATGTCACGCCGCAATCCCTTCTCCTCCA
TTCTCCTCTCAGGATCTTGGGCACGCACGCACACGTGCCCGGCGTGAGTTTAAGCCACCG
GGTCCAGGACGCGAACCGCGGTTGACTACGTGGGAGTCCAGGGACATAGCCATTACGCCA
CCTGCTGGTTCCCACAGCCCCAGTCTCTTGTTCCTCCAACTGTCTGTCTTTTCGCCTGTC
TCCTGCATCTCCGCCATGTCCCCTCTATCTCTCTCTCTCTAGGTCTGTCTCCCTCCATTT
GTCCCTCCATCTATCTCTGTCTCTCCCCTCCACCTCTGTCTCTATTCCTTCCCATTTTTT
TTTTTTTTGGAGAGATTTTCACTGTAGGGCGCATGCACTCGCCAGACAGACAGAGAGAGA
CAGAGAGACAGAAAGCGAGAAATCACCCCCCAGGGGGGATGGTCACGCCGCAATCCCTTC
TCCTCCATTCTCCTCTCGGGATCTTGGGCACGCACGCACACGCGCCCGGCGTGAGTTTAA
GCCACCGGGTCCAGGGCTCGAACCGCAGTCAACTACATGGGAGTCCAGCGACATAGCCAT
TATGCCAACTGGTGGTCCCTCTTTCCATTTTTGCCTCCATCTCTCTCATCTCCAGGATGC
CATCTGTCTCTCCCCTCCAGTCTCTCTCCCTCTGCCTCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNACACTAATAAATAAAGAATAATGTTTCTAGGATGAATAGAAG
TAGCTCACCATGACTGACAATGAAAACGTGAACACCTGAGAAACTGGAGTCGGGGGAGAA
TAAAGAATAACATATCAAAGACACAGAGCAGAGTATTTGGGAGAAATACCAAGGGTAAAA
GTAAAAAGAAAAATATTTATGTATTTTCATTCAATTGATTACAATTTCTTTCTATTGCTT
CTTATTTAAAAGAAGTCAAAATGTCATAAATATTAATGTGGACATAACTTTATTATGAGA
ATAAAATTTAAAACAAAGTTCTAAATATCAATCAGGTACATATGTGCGCTTTTTTCAACT
TGTCTCAACCATTTAGAATTCCTAGAACATTCCGCATACTGCAAACAAGATTTGTGCCTG
TGTCTGACAGAATTCATATCAGGCCTCTTAGAATTTATATGGAAACCTCACTCAAGATAA
TGCACAGGTGAGACCTCCTTATTTTATACTTTCTAGAAAAAATGTACAAAAGTTCTTCAT
ATGGGTTGTTCTACAGTTTCACTGTGCTTCTTTGATAATGCAAAGGCTTATCTACTGCCA
AGAAGGCACTTGGTATTACGAAGTGAAAAATTCCTCTCCATCCTTACTGTTCTCGTAACA
AGCAATGGCAGCTCCAGAGCTCAGATTTACAGAGCTGGTTGTAATTGTCCATCTTTTCTG
TGCCATTACCCTGGGACTCTAACCCTAATTCTATTCTGCAGAAGGGACTGTCAATCCATA
GATTAAAGGAACCTATTGGCTGACAGCTGGTTTTGCAGAGATGACTATGAAAGTGGTATG
CCCAACTTGTTTTTAAAGTTCTGCTAAAAAAAAAAAAAATGCACTGTCATGCTTGCCCTA
TAAAAGAGAAAACAGAGCTGGAGCAGTATTTGTATGCTGGAATCTTTATGTGAGAGCTCC
ATTAGGCAGTACAAAAGCACACCTGAAACCTACCTGCTGTGCTAAGCAACCAGACCCAAA
ATAGAATTCTTTTAAAAGACAAGTGTGGTCAGAAGTTATCTCACCACTCCAAAAATGTTA
TAACAATGGTTCAGATAGAAATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved