Tupaia_belangeri Locus Mono:119:SNORA72
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:119:SNORA72
Tupaia_belangeri
Mono:119:SNORA72
scaffold_139796
SNORA72
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAAAAAGTTGTTAATATCCTCTGTCT
GATTCTGTAATAATCAGGACAGGCTAAACATTCACTATAGTAAGATCATGTGTGTGTCCC
CAGACCTAATTCTTTCTCTATGTCTGATTTTATAAATGTTCATAATAAGCCAGGTAAAAA
AATCATTTAAAAAAAGAAAAAAATTAGTTTTGTCCCCATTCTAAAAGGACTTTTCAATTA
GATCAACTACATAGTTTCTTTAAATATTTAGTCCCCTGTTATATTTAGACTGCAATTAGA
TTAATGGGAGAAAATATTGACACTAACTTTTCAAGAACACACCCACTGCAGAAAGCAAAG
GGCATCTGTTGTTGATCTTATCTTTTAAATCTTAATGTCAAAAGTTGTTTTTACAGCCAG
GGATTTGCTTACAGAATAGTCCCACCCAAAGCTCTAGACCTTAGACTTTGGAGATGTGGG
TTAAGAGTGTGATCCTTTAAAAGCATCCTGCCTTGGACCTCCATGTCTGGACAATTGCTT
CAGTTCTCTACTTTCTAGACCCATTTCAACAGTTGCAAAGTAATTTAATGTTCCAAATGT
TGACACTGTGTTATTTCAACTTAGACTTTCTACATACACTGAAAATTTCAACCCCATAGA
ATATTGTGTTTGAACTTTTTTTAAAAAAGTTTTTTGTTTAGTTTTTGCTATAGGGCTTAT
GTGCTCGCTGGAGACACAAAGAGAACGTGAGAAATCACCCTGCAAGAAGAGTGCACAATG
CAATTCCCTCACCTCCACTCTCCTCTTGGGATCTTGAGCACACATGCACACACACCCGAC
ATGAGTTTCAAGCCATCAGGTCTAGGACTCAAATTGCAGTCAATCATGTGGGAGTCCAGC
ACCTTAACCACCATGTCACCTCCTGATCTTATGTTTGACTTTAAAAGTCCAGCATAAGAC
AGATAGAGCTAGAGGACAATGTTTGGGAAAGCAGCAAGTTGGAATCAAATGTAGCTGATG
CCAAGCGCAGGGACCCTATAACTCCAAATCCCATTAATGTGCCACACTCCATCCCATAAA
CCTTTGACAGACCTCCCTGCCTAGACATGGAAGGAGGAAGAAAATGATCAGAACAGCACT
GGGACAGCAATAACTTTGATAGTTGCTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved