Tupaia_belangeri Locus Mono:97:SNORD49
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:97:SNORD49
Tupaia_belangeri
Mono:97:SNORD49
scaffold_112120
SNORD49
1001..1071
2071
ATTCCCGGTGGCTTAAACTCACACCGGGCATGTATGTGTGCATGCCTAGGATCCCAATA
GGAGAATGGAGGAGAAGGTATTGTGGTGTGGCCATACCCCCCAGGGGGTGGTTTCTTGCT
TTCTGTCTCTCTGTCTCTCTCTGTCTTTCTGGCGAGCGCACACACACTATAGTAAAAACC
TCTAAAAAAAAAAAAACACAATGACATATCAACTAACCCCAGTCAGAATGGCGAAGATTG
AAAAGACAAATACGTGCTGAGAGAATGTGATGAAAGGGGGACATGCCTACACTATTGGTG
GAAATGTAAATTGGTCCAGCCACTGTGGAGAATGATATGGAGTTTCCTCAAAGACCTTCA
AATAGAACTACCATATGATTCAGCAATTCCACTCCTGGGTATCTTCACAGAGAACAGGAG
AGCACTCAGTCGCAAAAGCACTTGCACAACTATTTACATTTCAGCATTATTGACAATTGC
TAAGACTTGGAACTAACCCAAATGTCCACAAACAGATGAATAGACTGAAAATTTTTGGCG
CATATGTTCCATGGAATACTATTTCACCATAAAAAATAACAAGGCACATGAATTTGATAG
AAAGTGGATGAACATGGAAGATTTATTGCTGAGTGAAGTAAGTCAGGCTATGAAAGAGAG
ACATTGTATGTCTTCACTTAACATATACCAATGGCCTGCACTCTATGGTAGAGACTGAAA
GACTGGAGAACATAAAAGCATTAAAAATTGTAATGGACACTAGAGACAAGTGGAAAGAGA
GTGTGGGAGGGGAAAAGCTAAGGAAAAAAATTTAGGGGGAAAATGGAGAGGTAAGACATT
TGTGGGACACAGATAAAGTTTTTTATGTGTTGATGAGGATGTGTACAATAGTCTCAACTG
GGCTGGACTGAGGTGTATATCATGCTGAGTAAAGTCTCTTCACAATCTAAATGATGTATA
GCATTTTGATGTATGAATAATAATTAAAAAATTAATTTGAATGCTCTGATGAAATCACTA
ATAGGAAGTGCCGTCAGAAGCGATAACTGACAATAACTACTCCTGGCTGATTGTGGTCAA
CAAGCTCTCAGCACCTAGTGCCAGGGGTGAGTGTTACCGCTAGGTTGATGTGAACTCACT
GCTGTGTTTACACAGGTCATGAGTTAGCAAGTGCTCACCAGGTGCCGAGTGTTGGAGCCA
GGAGCACTGCCTGTCTGCCAGGTTTTGGAACCTGAGTGCTGGGGCACAGAGTACCAGCTG
GCAGTGGCCACAACTCGGCCCAGGACAAGGCTGTGTCCTCGGAGGATGAAATCCCAATGA
GTGGCTGCCATTGATTTGGGTTCTGAAAACGTAAATGGCTTCAGCTTTGTTACAAAGACA
TGCTGGTCTTGTTACCAGAAGCCCCATTCATCTCAAGGGAGCCAAGAGATGTACTTTTTC
CCAAGGACTGGTGAACTTCATATCATTAAATTCCTGAGCTTAAATTCTTGAGCATTGTCC
CCTGCCAGCTTGTCCGACAAGAACTTAATACATTTACTTTTGTAAATTGACTAAGTAAGA
AGGAATGAGTTCTTTAAGCTACAAACTGTTCATCTCCACCCCCACCCACAAATAAAGTTC
TCATGTAGTTACCATGAACTATTACTGAAATAAAGACTGGTCTTTGGTTTTGGTTTGGAA
AAAAATTAATTTAAAAAGATATGACTAAAAAGTGCACATATTCACTATATTCATACATTT
AAAAATTTATATATATAATATATAAATATATGTATATTTATAAAATACAAAATAGTTTTA
AGTTTTTTAAATATAGCATCAACAATTGGACTAAGGCTGTTACTGAATATATCACCTGAA
ATATTTCACATTTTCTATGATGAGAACTTTAATATCATGGTCTTTTGGCAGTATTAGAAT
AAATAGTACTCAATCATGAGTTACATTCACCATGTGCACACTCACCTTCATAAGCCTTCT
AAAATTGGTATATCCCACATTTCATCTTGCTTCTCCTTAGTTCCAGAAACCACAATTAAA
GCATTTTTTATTTTTCTTATATTCTGAAACAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved