Tupaia_belangeri Locus Mono:9:SNORA17
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:9:SNORA17
Tupaia_belangeri
Mono:9:SNORA17
scaffold_15779
SNORA17
1001..1136
2136
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCAAACCTACTGAAACTGAGTGCTCTGACTGGGAATTGACCCAGA
GCAAGTGAGAGATGAGAAAGCTACCAAACACACTGCTCCGAAAGGTAGTTTATAAATTCC
TGACAGAATGTTGGAGGGTAAAATTATGTTTCATGGAGCCAATCATTAACTTCTGCATTC
CTAATATGAAAACAAAACTCAGGACCCTTGAAATTCTGGCTGCAGAATGACCAAACATAA
GAGCTCAGTCATTTTCTTTCTTTTTAAAAATAATTATTTTACCTGCCCCTAGAGGCGTTG
CAGTTGTGGCTGCTGGGTCACAGCTGTGTCAGTAGTGGGCAGACAGCACAGAGGCTATGT
CTACGCTCAAGTGTTCTGACCCATGAACATTTGAATGATTAGTAGTAACCTGACACTTAA
AGTAACTAGACTGGAATTTTTATTTTTAAAATTTGTCTTTTTATTGTCCTTGATATCAGT
ATGGTGTCTTTTGTGTAAGTAAGCTAAATGATATGTATTTTGTTGGTCCTTACAGCATCC
TCCTGAAAAAGGAGATACAAAATAGTTACTTCTGTAATTTATGGATAAAACTTATAGCTC
AATAATATATTTATTATTTTTTAAAAGAATTATTTTATTTATTTAATTTACTTACTTATT
TTTAATTTGACTATAGAGGGACAGTATGTGAGAGAAGGAAACTGAGAAAGGAAGCCGCCA
GGTCTGGGACTCAAATTGCAGTGGGCCATGTGGGAGTCCAGCATCCTTAACCACCATGCC
ACCTGTCGTTCCCAGAGACAGCTCAGTCATTTTCAATCTGGTGCATTGACTCATAGAACT
TAAAACTTAATTTCAATCTTAAAACTTAATTTCAATCTGGTGCACTTGACTCATAGAACT
TAAAAACAAACAAACCCCAAAATGACAACTAAGACTTTAGTTCAGGACTTTCAGCTCTAT
CAACCTCTGCAAAACCTAGTTAATACAAGGTCAAGTCATAGTCCTCTGGACAGAAAACAT
AAACTCATCCTTATCAATTAACAAAGGCTCACTTTTGCAATCTTTTGCACTTTTACATAT
TTTCCAGATCCAAATACAGATGTTCTCGATATGATTTCTTAAAAGACACAAAATCTACAA
ACTTTCAAAATGCCTTTTGCAATATTTTGGGGGATATTTCTGATAGGGTCTCTTGCCATC
TCACAAATTCTCCTGCCCCAGCATCCCAACTAGCTAGGACTACAGATGAGATTGCACCAT
TTAGATCGGGCCAGGAACCAAACCCAGGTTGCCCTTTTGGCCTCAACCAGTGCAGCCTAA
GCCACTGCACCTGGGCCCTTGGCAATTCATATTAGTGTAGTAGCTGCCAGTACATAAGAT
GAGTACTCTTATCTGAAGTGCTTGGGATTCTAGTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved