Tupaia_belangeri Locus Mono:137:SNORA18
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:137:SNORA18
Tupaia_belangeri
Mono:137:SNORA18
GeneScaffold_3166
SNORA18
1001..1134
2134
ATTCCTTCCACAGCTTTATAAGTGGCTTCATCATTCTGTTCTTTCTGATCTAAATTATT
CTTCTAGACCAATTCTCTTAAATGCTCCCTTTCATCTTGTTGCTTCCCTATATATAGCCT
AAGTGCTTTCCAATTTGTTTTGAAACCAAGTCCGAACTTTTCTTCTTTGCCTTCAAGGTT
CTTTAAAATCTTTTGGCTTGACTCTCCTTTCCTAGGCCCGTCTCCTTCCTGTCATATAAA
AACATTATTATACTTCCAGCGTCTATGCCCTCATATAAACATGTTGAGTTGACCTGATCA
GAAAGAACCCAACCTTCTGCCTATCTTCACTCTTGTCTCTAATTCTTTCTAACTTGTTAC
CGCAGGTTCTTGATATAGTCAAGTACTGTAGTTCCCTGAAAACACATGCCCCCGGGCTTT
TGCTTTGCTTTTCCCTTCCACCCTTGTGCTTCTCCACCTCCCGTATTAATGCTTCCTTTA
TCTTGCCATTAGGCAAAGTAGCTTACACATCCCCTTGAGCCATCATTATTGGGTCCTCTA
CATACCTCTGTTATACCCTTTGTTACACAATTTTGCAGTGTCTTGGTTAGACAGCTGTCC
AATTTCTTTACTAGAGATCATGAGCTACCTTCTTAGAGTAGTTTAGACTTGGTTTCAAAA
CAGGCTCCTTGACCTTTAATAGCTCACATTTGTTTTATAATCCCAATGAATCATTTTAGT
CATTCAGTAGGTATTTGTTCAATGAATAAGTGAGCAAATTTCTACTTAAATCTTTCTCAT
TGTTCAAAGTTCAACTAAAATCACCCTATGTGTCTGAAACCTTTCTTGACGTTTTTAGTT
CTTCAGCCAGTCCCTGATGTCTGGTCATACTTACGGTTTGTACTATAAAAATCAGCAGTT
TCTTTAATTGAGTTGCAAGCTCCTTGAAGGCAGGGACACATATTTATGTTGTGTCTGTCA
TTGCATTGATTACAGTGCTAAGGACATAGAAAAACTAAATAGTTGAGGTGTGTGTCCTAA
TGGGGCTCTTCCTATAGATCTACATTATTGGAAACACCTTTTAGAGTATCTCTGTGGTTT
TGCTTTACTCAGAGGAATGTTCGTTAGATCTGTGGGAAGGCACCATGAGATGGAATTACC
AAAACTTTGAAAGATCTAATCATCCTTTTTTAACCCTAGGGAAAAAAACTAACTAAATAT
TTGCTTTTCAATTGAGTTACATAAATTCTGTGCTTAGGAAAATAATGACAGCTAATAATC
TACCTGGAAAATTAAATTTTTTTCTTAATTTTAATTTGTAGTCATGAAAATTAAATATTA
AATCATTCAGAAAATGTTTAGTGAATACCTACTAATTTCTTGACATTAAACCAGTGTTTG
AGATACACACATAAATTCTATCAGTAAAGAAATTCTTTCCAGGTAAAATTACTATTGCTA
CATGGAAGCTGTATACATTACTTTTACTTTCAAATTTGTAGATTTGTAAATTTTTAAAAA
ATATGTATTTAATTTTATTTATCATTATCATTGTTTTTAAAGTTTGCTACAGGGCATGTG
TGTTCACCAGAAAGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCCTAAGTG
AGAAAGCAAACTGCCAGGTCCCAGACTCAAACTTTGGTAGTCCCTGTGGGAGTCCAGTGT
CTCAGTCACCATGCCACTTAGAAGCCCCTAGATTTGTAAATTTTTAGTTGGCTAAATAAG
CAGTTTCTGAGTGACCATCAGATTACTTTTTTTGGGGGGGGAATAGGTACATTATAGCTC
TTCCTGGTTGATTTTTCTCAGTGGAGCACTGAATTTTTCTTGTATATGATATTGCGATGG
TTGAGAAATGAGGAGTATAAATATAGAATGATCTGGTCTTTTTTTTTTTTTTTTGACAAG
CCTATGCCCAGAAACTAGTAGGTTGGGCAGGATTAATAGAAGTTGTGTATAGTACACTAT
AACTTGAATGCTCTTTGGCTCACTTAGACTGACCAGATGCCATGGAGTTGTATCTGTCAT
GGCATTGTAATGACGGCTCACCAGCATTACTGATCAAAATCCCAGGGACTATCACCAAGC
ACATTTAGAGTAGATGGGCAGATACTGCCCTGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved