Tupaia_belangeri Locus Poly:12:SNORD58
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Poly:12:SNORD58
Tupaia_belangeri
Poly:12:SNORD58
GeneScaffold_4723
SNORD58, SNORD58
1001..1065, 4096..4159
5159
TCCAGGGGGTACATGATCAGGCAATTAAACTTAACAAAGTTGACAAATAAATGTCTCTT
TTATATCTTAAAAACATATGATCCTGTCATAGAACTACAAGCCTGTTTTTAAATAATACT
CAAAACCCAAAATGTATTTCTGAATACACAAAGAGTGGGGAATTTTGAGACAGTCTCTAA
GACAGCAATTCGTTTTATATGTTCTTAAAACATATTCCACACTCCCTTGTTCCTCCACTC
TCCGCCCTCTTTCAGCTCTCGTAGAGGAGACTGGAGATCTCGCGAGAGGTCGAATTCTCA
TGAATTCTCCCAGGAGCCACCGCTCTTCCTCTTCTCCGTAGCGGCCTGAGGTGAGTGTCT
CTGTGGCGTTGCTCCGAGTGCTCAATCCTCCCGCCATCGTCACCATCCTGGCCTGTGGGG
CATCGGCCTCATGTTCTCCACGAGCAGAACTCCCCGAACTACGGATTCCTCCTTAGAGGC
AGTGGTCTCTTGGGCGGGAGGATGTAGCAGAGAGCCTGATTTGTCGCGCCGTAGCTGGCC
GGTTTCTGCGGCCCTCAGGCACGCGATGGGTGGGATTGGGTGGCAGGGCCCTTTCGCAAG
TGGGGACACGGTCGGCCAGCATTCCATGCCGATTCCGACTTCGGAGATCCAGTGTCTCGC
GGTGAGTGTTGGCCCAGTACGCGGCGCATTTGTGGCCTCAACGAGAGGCTTTTGATGGGA
ATTCAAGTCGGGGCGAAGCGTCACTCGTTTTAACAGGACGGCTGTTAACGTGGGTGATTG
TCCATAGACTGCTGGGGCTGTGTGAGTGAAGGGGCGTTTTGTGGAGAGAGGACGTGGAGG
CTTGCAGTTGAGTTCCGCCGTGCCCGTGCGTCAAAACACTCCCCGAAAATCCAGGTTGCC
TTGGGTCATAGCTGTGCTCCGATCGGGAGGGACGGGAGAGCCACTGTTCTGTCACTGTCA
GTAAGGACTGTAGTCGGTTCCATAGGGGGAGAAAACAGTGGCTGCGATGATGCATTTCTT
AGGACACCTTTGGATTCATCATGAAAACAACTATTTTCTGAGCAGCTGTTGGTAGCTTAT
AATACTTAAACTGTAATGGTTATTGTAAATATGGGTCATTAACAAAATCTTGCTGCGCTT
TCTCCCAGGTGATCTTTGAAAATGGTTCGCTATTCACTTGACCCAGAGAACCCCACAAAG
TGTAAGTGAACAAGCCATTGATAAGTTTTATGTTGTGGGAGGTTAGCATATGAAGATACG
CAGCATTAATCAAAATATTTTCATTTTTTAGCATGCAAGTCAAGAGGTTCAAATCTTCGT
GTTCACTTTAAGGTACGTGGATCCCAGTTGAGTTGTGATCTGAGAGTTCTTCTACATGTT
CCCTTCAGTGATACTCTAAAAGGTAGCTGCAATGATGCCATTCTTAGGACACCTTTGGAT
TTACCATGAAAAGTAATAAATTCTGAGCAGCTACATTGTACTTTGGCATTGCATAGGGTC
CAGTAAAATGACGGGAACTACTTGATCTGGTGTACAGAGCAAGATAGGACATGTAATTGC
AGTGCAAGATAATGGAACTTTAATATTGCGTAGTGTGCATAAATGGAGGTTTAGGTTTAA
TTTTGCCTGGCTTCAAACAAATTTACCCCAGCTCTTAGTCACAGAATTTTTTTCATATTC
TCTCACCTCTCAAACATTGTGTAAGGGGTTAACTCTTGGTATATATTGACTTTGGGTGGG
GGGAGATTTTCGCTATAGGGCGTGCGCTCGACAGACAGACAGACAGCGAGAAATCACCCC
CCCAGGGGGGATGGTCACACCGCAGTCCGCGGCCCTTCTCATCCATTCTCCTCTCGGGAT
CTTGGGCACTCACGCATATGCGCCCAGCGGGAGTTTTAAGCCACCGGTCCAGGTCCAGGA
CACAAACCCGCAGTCAACCACGAACCCGCAGTCAACCACGTGGGAGTCCAGCGACATAGC
CATTACGCTAATTGCTGGTTCCCTGTATTGACATTTTTGAAAATCTGAAAATGTTTACTT
TTAAAATTCCAGTACTTTCACATGGTTAACCAATACTTCATTGTTACATTTAGAACACTC
GTGAAACTGCCCAGGCCATCAAGGGTATGCATATCCGAAAAGCCACCAAGTATCTGAAGG
ATGTCACTTTACAGAAGCAGTGTGTGCCATTCCGTCGTTACAATGGTGGAGTTGGTAGAT
GTGCCCAGGTGAGAATTCTTAGTTGCCATTTAAAAAGACAAATTTTGAGAAAGGGTGATT
GGATGGGATAAAATGGCTAAGGTGAGCTTTTACCATCTTCAATGACAGTCTTGGACACCT
TTGGATTACACTAACAGGTATATACATTCAGACAACCTTGATAGTGAATAANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTTCTGTTGTCCAAAATCATAAGCTCGT
TTGTCTGACTTTCACAGTAATTTATCTCTCATGTAAAGAAATTCTTAAAAGTTTTTATAC
AGTCTGCAGCGGGCCATTATCTGTGTGTGTAGATTTCCGCGAGCGTGGTCTGCAGTTCAT
CCAAACCTAAGCTCTATGCCTCCCTTCTCCCCAGTGCTGAGAAGTTGTGCTCTTTTTGAC
GCTCTCCTTATTCTCGGGAGATGTTTTACCAAGGAGTATTTTTCCTTTCATGTGCTGTAG
TATGTTTAATTATATACATGACTGTCTTAGTGCCTAAGGTGCTTTGTTGCGTGCAGTCAT
AATACAAACATGTTTCAGAAATAAGTTAAAATAATGATATATTAGATAAACCTTGGAATT
TCTTTATCTCTTTGCATTTGAAAGTCTGGGCCAGAATTGGAATTAATGGCTCCTAGCTTC
AATTCTGTTTATTACCAGGGCTTAGAAATTGGTAGTATGGTATCCATCAACCTCTTCAGC
TCTTTTAAGTTTTTGCCATAGGGAGGGAGCGGGCACTCCCTGGAGAGAAGGAGTGAGAAA
TCATCTCCTTGGGAGAAGGACACACATACACACACACATGATTTTCAAGCCACCAGGTCC
TGGATTTGAACTGTGGTTGACCATATGAGAGTCCAGTGCCTTAACTATTATACCACCTGA
TGGCCCCACCATCTTTTTATTATTTATTCATTTATTTTAATTTGATCAGAGAGAGTGAGA
ACAAGCCACCAGGTCCTGGACTCGAACAGTAGTCGGCCATGTGGGGGTGTCCAGCACCTC
AACCACCACGCCACCTGCTGGCTCTCCATGAGCTCTTTTTAATGATTTTAGGGCCGGCCA
CATAACAAACAGTGGAGTTTGCTGGTAACTTAGACACTTAAAGGTGAATGCTGTTTGCAG
TCACAAAGGATTGACTTTCAGAAATGGTTTCATAAGGCAGGGGCTTTGGGGTGAGATTGG
GAATTAGTATTTGTTTATGGTGTTGAGACAATTTAAAATGTTTATTTTGTGCCCTTTACC
CTCTTCCCAGGGGTTAGATGTAGATTCTCTGGTCATTGAGCACATTCAGGTGAACAAGGC
ACCAAAGATGCGCCGTCGTACTTACAGAGCTCATGGACGGATTAACCCATACATGAGTTC
CCCCTGCCACATCGAGATGATCCTCACTGAAAAGGAGCAAATTGTTCCTAAACCGGAAGA
GGAAGTTGCACAGAAGAAAAAGGTAAATTATCTTGCAACTGCTCAGCTTTCTTTGTGTGT
GAAGAATGATTTGTGGTTGCTGTGATGACTATCTTAGGACACCTTTGGAATAACCATGAA
AGCACATTATTCTGAGCAACCCTTTTCTTTATTTTGGCTTTTTAACAGTCCAATTTGTTC
CTCAACTAATGTAGTAATCTTACATTCAGTATATCAGGCAGTCCCATATGATTATCTGCT
GGTGGCCACACCTATACTTAAAGCTGGGCACTTGGGAATTGTTTTGTAATTGTCCCCTTA
AAGCCTAATGTATTCAACTTACATTGGTTTTATTGTTTAAATATCCCATCCTTGCTTCCG
CTGAGGCCTTACGGACTAGGCCTTCTGCCTCCAGTGTTCATTATAAAGTCCTCCAAGATA
AAGTGGGTTTCTCCAAGAAACTTAACCATCCTTTTATTTTTTCTTTCCGCAGATATCCCA
GAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAATAAAGTCAGCATAAAATAAATGT
AGATAAAAAAGGATATTGGTTGTCTTTATATCAGTATTTCCAGTGTCTTTACAGGGTGGA
TACAATTAGTTTACTCTGCACCAATGATTTTGACTCAAACATGCTGTTTTGAATTATTGC
TCCTTTGCATAAGATAGAGTTTAGAATGTGAGAAAATTCCTGAAACTGTTAGTTTTTCAA
CAGAGCTATTGAGATTTAGCACACCGTACAACTTACCCATTTACACTTTACTAATTTATT
CTTAGTAAGCTGTTATGCACACATCACATTGCCATCAATTTCGAACATTTTTTATTTTAT
CAAAAAGAAACAAGGTGGTGGTTGTCATTAACTCTACCCCTAGGTACCACTATTTTGTCT
TGTTTCAGTCTGTTCTTGACATTTTGTTGCAAATGAAGTCAGTAATTAACTCTTCACCAC
TAGCTTTCATTGAGCATGTTACCAGAGGTGAATGCTGTAACATGATCAGCACCTTATTTT
TATTTATTTTTTCTTTTAAGGTTTTTGCCATAGGCCTGTGTGCTTGCAGGAGAGAGATGG
ATCATCAGAATCCCTTCTCTAGTCTCAGGATTTGGGGTGTTCTACACATCTTTAAACTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved