Tupaia_belangeri Locus Mono:99:SNORA71
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri Mono:99:SNORA71
Tupaia_belangeri
Mono:99:SNORA71
scaffold_86229
SNORA71
1001..1125
2125
ATTTCTTGGAATAGTTTGAGAAGAATTGGAGAATTGGAATTAGTTCTTTTACAAAAACG
TTTTGTAGAATTCAGCAGTTAAACCATCTTTTCTTTGATGGGAGACTTCATTACAGATGC
AGTCTCATATGTTGTCATTGGTCTACTTGGGTTTTCTTTTCTTTTTCTTTTTTTTGAGAG
GTTTGTGCTATAGGGCATGTGTGCTCACCAGAAAGATAGAGACAGAGAGACAGAAAGCAA
GAAATCACTCCCCAGGGGAGATGGCTACGCCACAATCCCTTGTCCTCCATTCTCCTCTCA
GGATCTTGGGCACGCACACACACGTCTGGCGTGAGTTTAAGCCACCTGGTCCAGGATTCG
AACAGTGGTTAACTACATGGGAGTTCAGTGACGTAGCCATTACACCAGCTGCTGGTCCTG
TGGATTTTTTATTTCTTATTGGTTTAGTCTTGGTAGATTGTTTGTGGCCAAGGACTTATC
CATTTCACCTCTATTTTTCAGTCTATTGGCCTTTAGTTGTTCATAATAGTCTCTAATTAT
CTTTTGTATTTCTATGGTATCAATTATAATATCTCCTTTCTCATTTATGATTTTATTTAT
TTGGGTCATCTCTCATTTAATCTAGCTAACGGTTTGTTCATTTTGTCTGTGTTTTTTTTT
AATTGAACTTCTGCTTGATTGATCTTTTGTATTTTTTTCTTTATTTCTTTTCACAAGTTT
GCTCATTTCTTCTTTGATCTTTGTGATTTCCATTATCCTGTTGATATTGGGATTAGTTTG
TTCTTGTTTTTCTAGTTCCTTGGAGTGGATCGTTAGATTGTTTATTTGACCTCTATTTAT
TAATTGTTTTTGATGAGGGCACTTATTGCTATAAATGTCCCTCTTAGAACTGCTTTTACT
CTATTCATTAAGTTTGATATGTTGTATTTTAATTTTTATTTGTTTCTATAGATTTTTACA
TTTCCATCTTGATTTCATTTTTTAAAAGAATTATTTTATTGCCCTGCATTCAAAAGTGAC
CCTAGGCAGCCTGAGCCCTTGTCATTGATAGTGCAGGAGAGACTTGCTGAAAGCGTTTCC
CCGTGTTGAGGGTCACCCTGTCCTTCGACCCTGAAGCTTTCGTACATGACTCCGTTAGTC
CCCTTCTGCCAGCATGGCATGGTACTCGCAGATTATGTGGTGGATTCAGCAGCCTGTCTC
AGGGAGTTTGTGTTGATGGGCTGATTGTTTTAGAGCCATGAATAGGATCAGCCTCCTGGG
GTGCCTTCCCATTGCGCCCCCTGGGTGTCAGCACTGATCACACCTGGGGTCCTTGGCTTG
CTTACCACGACCCTGTGCTGTGAGCTTGCGGGCAGGGCCTCTGTCTTGTTTCACGGCCTT
CCTGGTGCCCAACACAGCACTGGACACAAATGAGAAGACCTAGTACAGTGGGCTCAGTCT
GAGATCCCAGAGACTGCAGAAGGAGGTCCCAAGGCTGTGGAGTCACCCTTGGGGTGACCT
AACTTACCGTGATGAGTTAATGCCGAGGGCTGGCAACCCATAGAAGCTAAGCTGGTTTCC
ACTTATGCAGATGGGAGCCCTAAACATCGGTCTCACCTATCCTTTCTTTTTAAAAAAAAA
AAAAAAAAGAATTATTTTATTTAAATTTATTTATTTATTTATGTATGTATTTATTCATTT
ATTTAAACTTGACCAGAGAGGGTCAGAATGAGAGAGAGCGAGCGAGAGAGAGAGAAAGTG
AGAAAGTAAGCTGTTAGGTCTGGGACTTGAACTGCAGTCGGCCATGTGGGATTCCAGCGC
CCTTAAGCACCGTGCCACCTGCTGGTATGATTTCATTTTTTAAAGAATTATTTTATGCTG
GGACCACCAGTTGGCATAATGACTATGTCACTGGATTCCCATCTAGTCGACCGTGGTTCG
TGTCCCGGGACCCGGTGGCTTAAAACATGCCTGGCGCGTGTGCGTGCGTGCCCAAGATCC
CGAGAGGAGAATGGAGGAGAAGGGATTGTGGCGTGGTCATCCCCCCTGGGGGGTGATTTC
TTGCTTTCTGTCTCTCTGTCTCTCTCTGTCTGTCTGGCGAGTGCACACATCCTATAGCAA
AAACCTCTCCAAAAAAAAAAAAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved